Transcript: Human NM_032410.4

Homo sapiens hook microtubule tethering protein 3 (HOOK3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HOOK3 (84376)
Length:
14348
CDS:
155..2311

Additional Resources:

NCBI RefSeq record:
NM_032410.4
NBCI Gene record:
HOOK3 (84376)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032410.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435521 GGAAACTCAGCCAGCTTATTT pLKO_005 2382 3UTR 100% 15.000 10.500 N HOOK3 n/a
2 TRCN0000421433 TGGCAGAGAATCAGGTATTAA pLKO_005 804 CDS 100% 15.000 10.500 N HOOK3 n/a
3 TRCN0000434420 CTCACAACACAAGGGTTAATG pLKO_005 1463 CDS 100% 13.200 9.240 N HOOK3 n/a
4 TRCN0000183531 GCTGAGACATTCTTCTGATAA pLKO.1 1069 CDS 100% 13.200 9.240 N HOOK3 n/a
5 TRCN0000433036 ATCCGTACTTTAGATCCTAAA pLKO_005 1997 CDS 100% 10.800 7.560 N HOOK3 n/a
6 TRCN0000149507 GCACCAGAAATACAAGCTCTT pLKO.1 2033 CDS 100% 4.050 2.835 N HOOK3 n/a
7 TRCN0000149116 GCAGAAGATTCAGTCCTTCTA pLKO.1 1766 CDS 100% 0.495 0.347 N HOOK3 n/a
8 TRCN0000149010 GCCATTATGATGATGGAGGAA pLKO.1 566 CDS 100% 2.640 1.584 N HOOK3 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6757 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4304 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4304 3UTR 100% 4.050 2.025 Y ORAI2 n/a
12 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4304 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6758 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4818 3UTR 100% 10.800 5.400 Y SMIM11A n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7531 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7531 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032410.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04389 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04389 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491752 CCAACGTTTTATCAGGTAAGACAT pLX_317 16.2% 100% 100% V5 n/a
Download CSV