Transcript: Mouse NM_033652.5

Mus musculus LIM homeobox transcription factor 1 alpha (Lmx1a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lmx1a (110648)
Length:
3338
CDS:
218..1366

Additional Resources:

NCBI RefSeq record:
NM_033652.5
NBCI Gene record:
Lmx1a (110648)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_033652.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433282 CATTATGGATTGCATAGTTTA pLKO_005 1541 3UTR 100% 13.200 18.480 N Lmx1a n/a
2 TRCN0000415771 TGTGAAGGGTTGCTGACTTTA pLKO_005 1419 3UTR 100% 13.200 9.240 N Lmx1a n/a
3 TRCN0000421644 GAAACTGTTTGCTGTCAAATG pLKO_005 478 CDS 100% 10.800 7.560 N Lmx1a n/a
4 TRCN0000070440 CCTATGGTGCTGAACCTCTTT pLKO.1 1200 CDS 100% 4.950 3.465 N Lmx1a n/a
5 TRCN0000070442 TGATGACACATCTCTCAGTAA pLKO.1 1237 CDS 100% 4.950 3.465 N Lmx1a n/a
6 TRCN0000070439 GCTCTACTGCAAGTACCACTA pLKO.1 454 CDS 100% 4.050 2.835 N Lmx1a n/a
7 TRCN0000070438 CGTCTACAACTCTGATCCCTT pLKO.1 1132 CDS 100% 2.640 1.848 N Lmx1a n/a
8 TRCN0000070441 CTCGGCATCTTTCTCCTCTTT pLKO.1 268 CDS 100% 4.950 2.970 N Lmx1a n/a
9 TRCN0000017213 CCCATATGGAACAACCATATT pLKO.1 1397 3UTR 100% 0.000 0.000 N LMX1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033652.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10949 pDONR223 100% 23.6% 25.6% None (many diffs) n/a
2 ccsbBroad304_10949 pLX_304 0% 23.6% 25.6% V5 (many diffs) n/a
3 TRCN0000469744 TAAGCACAGCGCGGATGTGGCCCA pLX_317 100% 23.6% 25.6% V5 (many diffs) n/a
Download CSV