Transcript: Mouse NM_053069.6

Mus musculus autophagy related 5 (Atg5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Atg5 (11793)
Length:
2396
CDS:
305..1132

Additional Resources:

NCBI RefSeq record:
NM_053069.6
NBCI Gene record:
Atg5 (11793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_053069.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375754 AGCCTCCTCTTCTCGTGAAAT pLKO_005 1334 3UTR 100% 13.200 9.240 N Atg5 n/a
2 TRCN0000375819 AGCCGAAGCCTTTGCTCAATG pLKO_005 1362 3UTR 100% 10.800 7.560 N Atg5 n/a
3 TRCN0000099430 GCCAAGTATCTGTCTATGATA pLKO.1 1965 3UTR 100% 5.625 3.938 N Atg5 n/a
4 TRCN0000099431 CCTTGGAACATCACAGTACAT pLKO.1 593 CDS 100% 4.950 3.465 N Atg5 n/a
5 TRCN0000327358 CCTTGGAACATCACAGTACAT pLKO_005 593 CDS 100% 4.950 3.465 N Atg5 n/a
6 TRCN0000099434 CCCTGAAATGGCATTATCCAA pLKO.1 531 CDS 100% 3.000 2.100 N Atg5 n/a
7 TRCN0000327456 CCCTGAAATGGCATTATCCAA pLKO_005 531 CDS 100% 3.000 2.100 N Atg5 n/a
8 TRCN0000099432 GCAGAACCATACTATTTGCTT pLKO.1 398 CDS 100% 3.000 2.100 N Atg5 n/a
9 TRCN0000150940 GCAGAACCATACTATTTGCTT pLKO.1 398 CDS 100% 3.000 2.100 N ATG5 n/a
10 TRCN0000363558 GCAGAACCATACTATTTGCTT pLKO_005 398 CDS 100% 3.000 2.100 N Atg5 n/a
11 TRCN0000099433 GCATCTGAGCTACCCAGATAA pLKO.1 1072 CDS 100% 1.320 0.924 N Atg5 n/a
12 TRCN0000327377 GCATCTGAGCTACCCAGATAA pLKO_005 1072 CDS 100% 1.320 0.924 N Atg5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_053069.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02173 pDONR223 100% 91.7% 96.7% None (many diffs) n/a
2 ccsbBroad304_02173 pLX_304 81.1% 91.7% 96.7% V5 (many diffs) n/a
3 TRCN0000474030 TTCTCCACCGCGACTTCCTGCAGG pLX_317 59.4% 91.7% 96.7% V5 (many diffs) n/a
Download CSV