Transcript: Human NM_133646.3

Homo sapiens mitogen-activated protein kinase kinase kinase 20 (MAP3K20), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K20 (51776)
Length:
7175
CDS:
192..1559

Additional Resources:

NCBI RefSeq record:
NM_133646.3
NBCI Gene record:
MAP3K20 (51776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133646.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003267 ACGAGAGATTAACCATTCCAA pLKO.1 856 CDS 100% 3.000 4.200 N MAP3K20 n/a
2 TRCN0000342566 ACGAGAGATTAACCATTCCAA pLKO_005 856 CDS 100% 3.000 4.200 N MAP3K20 n/a
3 TRCN0000322188 CAAGTCAAGAAACGTTGTTAT pLKO_005 593 CDS 100% 13.200 9.240 N Map3k20 n/a
4 TRCN0000195071 CAGAAACTTGTGACACATATT pLKO.1 742 CDS 100% 13.200 9.240 N MAP3K20 n/a
5 TRCN0000003268 CCATAACCATACAACACACAT pLKO.1 662 CDS 100% 4.950 3.465 N MAP3K20 n/a
6 TRCN0000342617 CCATAACCATACAACACACAT pLKO_005 662 CDS 100% 4.950 3.465 N MAP3K20 n/a
7 TRCN0000003266 CCTCAGTCACAGAAACATCAT pLKO.1 368 CDS 100% 4.950 3.465 N MAP3K20 n/a
8 TRCN0000352644 CCTCAGTCACAGAAACATCAT pLKO_005 368 CDS 100% 4.950 3.465 N MAP3K20 n/a
9 TRCN0000003265 GCTTCTCTGGGATCACTCTAT pLKO.1 444 CDS 100% 4.950 3.465 N MAP3K20 n/a
10 TRCN0000342564 GCTTCTCTGGGATCACTCTAT pLKO_005 444 CDS 100% 4.950 3.465 N MAP3K20 n/a
11 TRCN0000195308 CGAGCCAAATGGATATCACAG pLKO.1 285 CDS 100% 4.050 2.835 N MAP3K20 n/a
12 TRCN0000003264 ACAGTAACAGAAGTGAGGAGA pLKO.1 475 CDS 100% 2.640 1.848 N MAP3K20 n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5360 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5361 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 5435 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133646.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03382 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03382 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473777 CTCAGGTTCCCCGAGCCGGTACAA pLX_317 36.3% 100% 100% V5 n/a
4 ccsbBroadEn_15075 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_15075 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000472501 AAAAAGCCCACAAAACCTTACCCA pLX_317 30.5% 100% 100% V5 n/a
7 TRCN0000487828 GCGGTGCAAGTAACACGGGGCACT pLX_317 20.2% 99.9% 100% V5 (not translated due to prior stop codon) 439T>C n/a
8 TRCN0000492308 CTGCATTGCCGATATCTGGATTAT pLX_317 34% 99.8% 99.7% V5 439T>C;1365_1366insG n/a
Download CSV