Transcript: Mouse NM_133940.3

Mus musculus F-box and leucine-rich repeat protein 14 (Fbxl14), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxl14 (101358)
Length:
4219
CDS:
193..1395

Additional Resources:

NCBI RefSeq record:
NM_133940.3
NBCI Gene record:
Fbxl14 (101358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133940.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200380 GCCAGAAACTCACGGATCTTT pLKO.1 827 CDS 100% 5.625 7.875 N Fbxl14 n/a
2 TRCN0000177949 GCACAAATGTATGGGAGAAAT pLKO.1 2345 3UTR 100% 13.200 10.560 N Fbxl14 n/a
3 TRCN0000182658 GCCTGCCTTCACTTACACTTT pLKO.1 1757 3UTR 100% 4.950 3.465 N Fbxl14 n/a
4 TRCN0000245552 CTGCTACAACCTCACCGACAA pLKO_005 489 CDS 100% 4.050 2.430 N FBXL14 n/a
5 TRCN0000182406 GATCTTCGGCTACTTGGACTT pLKO.1 237 CDS 100% 4.050 5.670 N Fbxl14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133940.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09614 pDONR223 100% 90% 95.2% None (many diffs) n/a
2 ccsbBroad304_09614 pLX_304 0% 90% 95.2% V5 (many diffs) n/a
3 TRCN0000467182 AGCTGAGAAGCTCAGATATCAATT pLX_317 22.6% 90% 95.2% V5 (many diffs) n/a
Download CSV