Transcript: Mouse NM_134123.3

Mus musculus SR-related CTD-associated factor 8 (Scaf8), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Scaf8 (106583)
Length:
4892
CDS:
418..4224

Additional Resources:

NCBI RefSeq record:
NM_134123.3
NBCI Gene record:
Scaf8 (106583)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339194 CCGGTAGTACCAACATCTTTA pLKO_005 2542 CDS 100% 13.200 18.480 N Scaf8 n/a
2 TRCN0000339263 TATTCACTGAATGACTATAAG pLKO_005 451 CDS 100% 13.200 18.480 N Scaf8 n/a
3 TRCN0000339193 TGACTCCATTGTGCGACAATC pLKO_005 615 CDS 100% 10.800 8.640 N Scaf8 n/a
4 TRCN0000339265 GGGTATGGCAATGACATATTT pLKO_005 4540 3UTR 100% 15.000 10.500 N Scaf8 n/a
5 TRCN0000339264 TAACATCACTCAGTAGGTAAA pLKO_005 4222 CDS 100% 10.800 7.560 N Scaf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07805 pDONR223 100% 88.3% 91.3% None (many diffs) n/a
2 ccsbBroad304_07805 pLX_304 0% 88.3% 91.3% V5 (many diffs) n/a
3 TRCN0000470849 GCCGAACTCATGCTACGTGTAGAC pLX_317 9.3% 88.3% 91.3% V5 (many diffs) n/a
Download CSV