Transcript: Human NM_134260.2

Homo sapiens RAR related orphan receptor A (RORA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RORA (6095)
Length:
10998
CDS:
157..1827

Additional Resources:

NCBI RefSeq record:
NM_134260.2
NBCI Gene record:
RORA (6095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_134260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022155 CCAAACGCATTGATGGATTTA pLKO.1 1268 CDS 100% 13.200 18.480 N RORA n/a
2 TRCN0000022157 GAATCCATTATGGTGTCATTA pLKO.1 500 CDS 100% 13.200 18.480 N RORA n/a
3 TRCN0000437977 ATAGCGGAGGTTGCGGCATTA pLKO_005 2223 3UTR 100% 10.800 15.120 N RORA n/a
4 TRCN0000022154 CCAGACATTGTGCGACTTCAT pLKO.1 1741 CDS 100% 4.950 6.930 N RORA n/a
5 TRCN0000431023 ATGCAAATTGATGGGTAAATG pLKO_005 1810 CDS 100% 13.200 9.240 N RORA n/a
6 TRCN0000430461 CAACAGGAGGAGGGTACTAAA pLKO_005 2095 3UTR 100% 13.200 9.240 N RORA n/a
7 TRCN0000022158 CCTTAGGTTGTGAAGACTTTA pLKO.1 1433 CDS 100% 13.200 9.240 N RORA n/a
8 TRCN0000022156 GCATCTGGAAACCTGCCAATA pLKO.1 1104 CDS 100% 10.800 7.560 N RORA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488554 CCGGAAAGGCAAATATTAGTTTAT pLX_317 22.8% 87.2% 83.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491974 CACAAGTCCTCGTCATGAGGGAAC pLX_317 17.3% 82.8% 81.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13944 pDONR223 100% 82.7% 81.6% None (many diffs) n/a
4 ccsbBroad304_13944 pLX_304 0% 82.7% 81.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV