Transcript: Human NM_144996.4

Homo sapiens ADP ribosylation factor like GTPase 13B (ARL13B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ARL13B (200894)
Length:
3650
CDS:
270..1235

Additional Resources:

NCBI RefSeq record:
NM_144996.4
NBCI Gene record:
ARL13B (200894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144996.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229360 ACCGGGTAGAACCACTTAATA pLKO_005 1018 CDS 100% 15.000 21.000 N ARL13B n/a
2 TRCN0000064951 CCGGGTAGAACCACTTAATAT pLKO.1 1019 CDS 100% 15.000 21.000 N ARL13B n/a
3 TRCN0000064948 CCTTAAATGAACGCATCCAAA pLKO.1 535 CDS 100% 4.950 6.930 N ARL13B n/a
4 TRCN0000218563 GGCATTAACACAGCAGTTAAA pLKO_005 914 CDS 100% 1.320 1.848 N ARL13B n/a
5 TRCN0000229361 CATCGTAATTTGACCTAATTT pLKO_005 1869 3UTR 100% 15.000 10.500 N ARL13B n/a
6 TRCN0000064950 CCAGCCAATAGCATCTGTAAT pLKO.1 719 CDS 100% 13.200 9.240 N ARL13B n/a
7 TRCN0000218877 CATCATTGGAATCAGCTAATG pLKO_005 958 CDS 100% 10.800 7.560 N ARL13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144996.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05195 pDONR223 100% 75% 75% None 59_60ins321 n/a
2 ccsbBroad304_05195 pLX_304 0% 75% 75% V5 59_60ins321 n/a
3 TRCN0000471890 TCAGTCACTACGGACACAAGATGA pLX_317 31.9% 75% 75% V5 59_60ins321 n/a
Download CSV