Transcript: Human NM_145899.3

Homo sapiens high mobility group AT-hook 1 (HMGA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
HMGA1 (3159)
Length:
1920
CDS:
250..573

Additional Resources:

NCBI RefSeq record:
NM_145899.3
NBCI Gene record:
HMGA1 (3159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018949 CAACTCCAGGAAGGAAACCAA pLKO.1 479 CDS 100% 3.000 2.100 N HMGA1 n/a
2 TRCN0000297451 CAACTCCAGGAAGGAAACCAA pLKO_005 479 CDS 100% 3.000 2.100 N HMGA1 n/a
3 TRCN0000018950 CCAGCGAAGTGCCAACACCTA pLKO.1 392 CDS 100% 0.880 0.616 N HMGA1 n/a
4 TRCN0000351004 CCAGCGAAGTGCCAACACCTA pLKO_005 392 CDS 100% 0.880 0.616 N HMGA1 n/a
5 TRCN0000018951 CCTTGGCCTCCAAGCAGGAAA pLKO.1 281 CDS 100% 1.650 0.990 N HMGA1 n/a
6 TRCN0000278425 CCTTGGCCTCCAAGCAGGAAA pLKO_005 281 CDS 100% 1.650 0.990 N HMGA1 n/a
7 TRCN0000018952 GAAGGAGGAAGAGGAGGGCAT pLKO.1 522 CDS 100% 0.720 0.432 N HMGA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00758 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00758 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468722 GACAACGTCTGGAAGTTCCATGGT pLX_317 68.6% 100% 100% V5 n/a
4 ccsbBroadEn_00757 pDONR223 100% 89.7% 89.7% None 102_134del n/a
5 ccsbBroad304_00757 pLX_304 0% 89.7% 89.7% V5 102_134del n/a
6 TRCN0000470345 TTTATAAACCATCACTACACGCGA pLX_317 100% 89.7% 89.7% V5 102_134del n/a
Download CSV