Transcript: Mouse NM_147061.1

Mus musculus olfactory receptor 691 (Olfr691), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr691 (259063)
Length:
969
CDS:
1..969

Additional Resources:

NCBI RefSeq record:
NM_147061.1
NBCI Gene record:
Olfr691 (259063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_147061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185262 GCTTAGCTTGTGCAGATATAA pLKO.1 563 CDS 100% 15.000 10.500 N Olfr691 n/a
2 TRCN0000185579 CTGTATTATCTTTCCTGTGAT pLKO.1 465 CDS 100% 4.950 3.465 N Olfr691 n/a
3 TRCN0000185223 CTTGTGCAGATATAACTGTTA pLKO.1 569 CDS 100% 4.950 3.465 N Olfr691 n/a
4 TRCN0000187163 CCCACTGAGATATGCAACAGT pLKO.1 390 CDS 100% 3.000 2.100 N Olfr691 n/a
5 TRCN0000202642 CATTGTGGATGTGATTCTCAT pLKO.1 627 CDS 100% 4.950 2.970 N Olfr691 n/a
6 TRCN0000204443 CCATTCCTACTGTGAGCACAT pLKO.1 531 CDS 100% 4.050 2.025 Y OR52J3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05309 pDONR223 100% 84.2% 87.9% None (many diffs) n/a
2 ccsbBroad304_05309 pLX_304 0% 84.2% 87.9% V5 (many diffs) n/a
3 TRCN0000477834 GTTTACCTGATGACCTTCCGGGGA pLX_317 31.2% 84.2% 87.9% V5 (many diffs) n/a
4 TRCN0000488277 CCGAGTTCGCCTCCTATACGTGTT pLX_317 31.3% 84.2% 87.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491509 GCGTTGAAGCTGGTTCCTGGGATT pLX_317 28.7% 84.1% 87.6% V5 (many diffs) n/a
Download CSV