Transcript: Human NM_152540.4

Homo sapiens sec1 family domain containing 2 (SCFD2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SCFD2 (152579)
Length:
3162
CDS:
121..2175

Additional Resources:

NCBI RefSeq record:
NM_152540.4
NBCI Gene record:
SCFD2 (152579)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152540.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159653 GCAATGTCCGTTGTGTTAAAT pLKO.1 1447 CDS 100% 15.000 21.000 N SCFD2 n/a
2 TRCN0000163431 GCCGTGGATGAACTCTTTACT pLKO.1 1726 CDS 100% 5.625 7.875 N SCFD2 n/a
3 TRCN0000160173 CCACCTAGTGAAACTTTGTAA pLKO.1 3036 3UTR 100% 5.625 4.500 N SCFD2 n/a
4 TRCN0000163071 CGCAGTCACTTCCAGTATTGT pLKO.1 403 CDS 100% 5.625 4.500 N SCFD2 n/a
5 TRCN0000163467 GAGGCCAGATTCCGTTGATAT pLKO.1 1881 CDS 100% 13.200 9.240 N SCFD2 n/a
6 TRCN0000162230 CCTGTCACTAATTGCGAGAAT pLKO.1 2266 3UTR 100% 4.950 3.465 N SCFD2 n/a
7 TRCN0000198048 CTCAGTTCTCTGTGTGAACAT pLKO.1 787 CDS 100% 4.950 3.465 N Scfd2 n/a
8 TRCN0000164508 CTTTGCCTTGACTCCAGCTTT pLKO.1 618 CDS 100% 4.950 3.465 N SCFD2 n/a
9 TRCN0000163244 GTCAGCAATGTCCGTTGTGTT pLKO.1 1443 CDS 100% 4.950 3.465 N SCFD2 n/a
10 TRCN0000162433 CCAGGCATCTTATAAGCCATT pLKO.1 1824 CDS 100% 4.050 2.835 N SCFD2 n/a
11 TRCN0000164099 CCCTGTCACTAATTGCGAGAA pLKO.1 2265 3UTR 100% 4.050 2.835 N SCFD2 n/a
12 TRCN0000161711 GCCATAACAAAGGACTGCATT pLKO.1 2756 3UTR 100% 4.950 2.970 N SCFD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152540.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09688 pDONR223 100% 99.9% 100% None 1458G>A n/a
2 ccsbBroad304_09688 pLX_304 0% 99.9% 100% V5 1458G>A n/a
3 TRCN0000476080 TACCGGACCTGCCAAGGTCGGAAT pLX_317 17% 99.9% 100% V5 1458G>A n/a
Download CSV