Transcript: Human NM_153828.3

Homo sapiens reticulon 4 (RTN4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
RTN4 (57142)
Length:
2240
CDS:
152..1273

Additional Resources:

NCBI RefSeq record:
NM_153828.3
NBCI Gene record:
RTN4 (57142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417227 GTATGGATTTAAACCGTAATC pLKO_005 1485 3UTR 100% 10.800 15.120 N RTN4 n/a
2 TRCN0000420965 AGACGAGATCATACCGGTAAA pLKO_005 1707 3UTR 100% 10.800 8.640 N RTN4 n/a
3 TRCN0000071688 GCAGTGTTGATGTGGGTATTT pLKO.1 1058 CDS 100% 13.200 9.240 N Rtn4 n/a
4 TRCN0000179649 GCAGTGTTGATGTGGGTATTT pLKO.1 1058 CDS 100% 13.200 9.240 N RTN4 n/a
5 TRCN0000183585 GCTGCTTTCATTGACAGTATT pLKO.1 775 CDS 100% 13.200 9.240 N RTN4 n/a
6 TRCN0000147624 GCATATCTGGAATCTGAAGTT pLKO.1 917 CDS 100% 4.950 3.465 N RTN4 n/a
7 TRCN0000179762 GCTATATCTGAGGAGTTGGTT pLKO.1 938 CDS 100% 3.000 2.100 N RTN4 n/a
8 TRCN0000147846 GAAGTACAGTAATTCTGCTCT pLKO.1 961 CDS 100% 2.640 1.848 N RTN4 n/a
9 TRCN0000146691 CCTGTTATTTATGAACGGCAT pLKO.1 1148 CDS 100% 2.160 1.512 N RTN4 n/a
10 TRCN0000435974 AGTTGATGATTTAGTTGATTC pLKO_005 1027 CDS 100% 10.800 6.480 N RTN4 n/a
11 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 255 CDS 100% 4.050 2.025 Y Myt1 n/a
12 TRCN0000375427 CCACCCATTCAGGGCATATTT pLKO_005 904 CDS 100% 15.000 21.000 N Rtn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03794 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03794 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468620 AGCCAACAGCAGTTTGATTGCGGT pLX_317 33.1% 100% 100% V5 n/a
4 ccsbBroadEn_03793 pDONR223 100% 95.1% 95.1% None 555_556ins57 n/a
5 ccsbBroad304_03793 pLX_304 0% 95.1% 95.1% V5 555_556ins57 n/a
6 TRCN0000473077 TTAAATCCGCAGGACACTGCGCTG pLX_317 37.4% 95.1% 95.1% V5 555_556ins57 n/a
7 ccsbBroadEn_15938 pDONR223 0% 91.7% 91.6% None (many diffs) n/a
8 ccsbBroadEn_15937 pDONR223 0% 50.4% 50.4% None (many diffs) n/a
Download CSV