Transcript: Human NM_173462.4

Homo sapiens papilin, proteoglycan like sulfated glycoprotein (PAPLN), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PAPLN (89932)
Length:
5808
CDS:
94..3849

Additional Resources:

NCBI RefSeq record:
NM_173462.4
NBCI Gene record:
PAPLN (89932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173462.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433793 AGCTTTGTGGCAATGAGTATT pLKO_005 3764 CDS 100% 13.200 18.480 N PAPLN n/a
2 TRCN0000073423 GCAATCTGTTTGGATAAGAAA pLKO.1 4089 3UTR 100% 5.625 7.875 N PAPLN n/a
3 TRCN0000073426 CCAATGTAACCGCTTCTGGTA pLKO.1 2343 CDS 100% 2.640 3.696 N PAPLN n/a
4 TRCN0000446368 AGATGGCACGCTGCTCATTTA pLKO_005 3561 CDS 100% 13.200 10.560 N PAPLN n/a
5 TRCN0000426480 AGATCCAACTTCGCATCATAG pLKO_005 2978 CDS 100% 10.800 8.640 N PAPLN n/a
6 TRCN0000420886 GCAGGCACCTTTGACGCTAAT pLKO_005 649 CDS 100% 10.800 7.560 N PAPLN n/a
7 TRCN0000073424 CCCAAACAAGTGTGAACTGAA pLKO.1 429 CDS 100% 4.950 3.465 N PAPLN n/a
8 TRCN0000073427 GCCAGGCTATTGTGTGTGGTA pLKO.1 3460 CDS 100% 2.640 1.848 N PAPLN n/a
9 TRCN0000436023 GTTACACAGGAATAGTTAAAT pLKO_005 4142 3UTR 100% 15.000 9.000 N PAPLN n/a
10 TRCN0000073425 GCCTGCAAACAGGCTGCGTTT pLKO.1 3126 CDS 100% 0.135 0.081 N PAPLN n/a
11 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 4625 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4422 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4422 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173462.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12929 pDONR223 100% 10.1% 9.8% None (many diffs) n/a
2 ccsbBroad304_12929 pLX_304 0% 10.1% 9.8% V5 (many diffs) n/a
3 TRCN0000470729 AAAAGCGCGGATTCACTAAACTAC pLX_317 100% 10.1% 9.8% V5 (many diffs) n/a
Download CSV