Transcript: Mouse NM_174998.4

Mus musculus hippocalcin-like 4 (Hpcal4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Hpcal4 (170638)
Length:
4652
CDS:
233..808

Additional Resources:

NCBI RefSeq record:
NM_174998.4
NBCI Gene record:
Hpcal4 (170638)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_174998.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104734 TGGGCCTTTGAGATGTACGAT pLKO.1 539 CDS 100% 3.000 4.200 N Hpcal4 n/a
2 TRCN0000104730 CCCAGGATTATGGTCCAAATA pLKO.1 1159 3UTR 100% 13.200 10.560 N Hpcal4 n/a
3 TRCN0000104733 AGGATAAGGATGACCAGATTA pLKO.1 711 CDS 100% 13.200 9.240 N Hpcal4 n/a
4 TRCN0000104732 CTATATCAAGTTCTTCCCTTA pLKO.1 385 CDS 100% 4.050 2.835 N Hpcal4 n/a
5 TRCN0000104731 CAGGAGCTAAAGCAGTGGTAT pLKO.1 305 CDS 100% 4.950 2.970 N Hpcal4 n/a
6 TRCN0000053955 GCAGTGTGACATGCAGAAGTA pLKO.1 787 CDS 100% 4.950 2.970 N HPCAL4 n/a
7 TRCN0000174226 GCAGTGTGACATGCAGAAGTA pLKO.1 787 CDS 100% 4.950 2.970 N HPCAL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174998.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08291 pDONR223 100% 93.1% 98.9% None (many diffs) n/a
2 ccsbBroad304_08291 pLX_304 0% 93.1% 98.9% V5 (many diffs) n/a
3 TRCN0000467506 CTTTGTACGCTATGCCTAGTGATC pLX_317 62.5% 93.1% 98.9% V5 (many diffs) n/a
4 ccsbBroadEn_07132 pDONR223 100% 81.1% 89% None (many diffs) n/a
5 ccsbBroad304_07132 pLX_304 0% 81.1% 89% V5 (many diffs) n/a
6 TRCN0000478956 GGGCGAGAATCGAAAAATCGCACT pLX_317 60% 81.1% 89% V5 (many diffs) n/a
Download CSV