Transcript: Mouse NM_175543.3

Mus musculus RAB11 family interacting protein 4 (class II) (Rab11fip4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rab11fip4 (268451)
Length:
3145
CDS:
65..1972

Additional Resources:

NCBI RefSeq record:
NM_175543.3
NBCI Gene record:
Rab11fip4 (268451)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175543.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121443 CGGGATCAGAATGATGATTTA pLKO.1 1727 CDS 100% 13.200 18.480 N Rab11fip4 n/a
2 TRCN0000417405 AGCAACGAGGAGCAATTTGAA pLKO_005 692 CDS 100% 5.625 7.875 N Rab11fip4 n/a
3 TRCN0000437231 GGACCTTTACAAGCGCATGAT pLKO_005 1477 CDS 100% 4.950 6.930 N Rab11fip4 n/a
4 TRCN0000121442 CCGTCAATACATGATGGGAAT pLKO.1 2968 3UTR 100% 4.050 5.670 N Rab11fip4 n/a
5 TRCN0000121445 CGCGGAGTATTCGCCATGAAA pLKO.1 290 CDS 100% 5.625 4.500 N Rab11fip4 n/a
6 TRCN0000417512 CCCTCCATCTTGGAGATTAAA pLKO_005 1946 CDS 100% 15.000 10.500 N Rab11fip4 n/a
7 TRCN0000412444 AGTAACTTCAGCAGCAGTAAT pLKO_005 1007 CDS 100% 13.200 9.240 N Rab11fip4 n/a
8 TRCN0000427444 CTGTTACATTCTCCAGAATTT pLKO_005 2360 3UTR 100% 13.200 9.240 N Rab11fip4 n/a
9 TRCN0000121444 GAGACAGTACATGGACAAGAT pLKO.1 1900 CDS 100% 4.950 3.465 N Rab11fip4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175543.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09188 pDONR223 100% 87.6% 92.6% None (many diffs) n/a
2 ccsbBroad304_09188 pLX_304 0% 87.6% 92.6% V5 (many diffs) n/a
3 TRCN0000491312 CGAGTGTGCGGCGCCGCGCAGCCA pLX_317 11% 87.6% 92.6% V5 (many diffs) n/a
Download CSV