Transcript: Mouse NM_177161.4

Mus musculus procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III (P4ha3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
P4ha3 (320452)
Length:
2361
CDS:
14..1642

Additional Resources:

NCBI RefSeq record:
NM_177161.4
NBCI Gene record:
P4ha3 (320452)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177161.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076476 GATTCTATGACAAGGTACTTT pLKO.1 207 CDS 100% 5.625 4.500 N P4ha3 n/a
2 TRCN0000076475 CCAGCCAACACACTACCAAAT pLKO.1 937 CDS 100% 10.800 7.560 N P4ha3 n/a
3 TRCN0000076474 CCAGGTGGTGAACTATGGAAT pLKO.1 1285 CDS 100% 4.950 3.465 N P4ha3 n/a
4 TRCN0000076473 CCTGTAGTGAATCCTCTACTT pLKO.1 251 CDS 100% 4.950 3.465 N P4ha3 n/a
5 TRCN0000076477 CCTTGTCTACAGCCCAGACAA pLKO.1 766 CDS 100% 0.495 0.347 N P4ha3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1962 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177161.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05351 pDONR223 100% 87.7% 90% None (many diffs) n/a
2 ccsbBroad304_05351 pLX_304 0% 87.7% 90% V5 (many diffs) n/a
3 TRCN0000468375 GCCGCGCTATGGAGGCTTTGTAGT pLX_317 28% 87.7% 90% V5 (many diffs) n/a
4 ccsbBroadEn_16145 pDONR223 0% 87.7% 89.8% None (many diffs) n/a
5 ccsbBroad304_16145 pLX_304 0% 87.7% 89.8% V5 (many diffs) n/a
6 TRCN0000480866 ACATAATCAGAGATTATTCCTTTT pLX_317 43.6% 54.3% 54.4% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489677 GATCCTCGCTGGTCCGTACAACAA pLX_317 24.5% 87.6% 89.7% V5 (many diffs) n/a
8 TRCN0000488796 GAGGTACCTGTGTTACCTTATACA pLX_317 21.1% 87.2% 89.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV