Transcript: Mouse NM_177338.6

Mus musculus homeobox containing 1 (Hmbox1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Hmbox1 (219150)
Length:
6073
CDS:
339..1598

Additional Resources:

NCBI RefSeq record:
NM_177338.6
NBCI Gene record:
Hmbox1 (219150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177338.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015009 CCGATGGTATCAACTTGAGAA pLKO.1 1004 CDS 100% 4.950 6.930 N HMBOX1 n/a
2 TRCN0000273599 GAAAGTGCTTCCAGGTATTTA pLKO_005 1874 3UTR 100% 15.000 12.000 N HMBOX1 n/a
3 TRCN0000085934 CGGGATGACCAAACATGAAAT pLKO.1 446 CDS 100% 13.200 9.240 N Hmbox1 n/a
4 TRCN0000331771 CGGGATGACCAAACATGAAAT pLKO_005 446 CDS 100% 13.200 9.240 N Hmbox1 n/a
5 TRCN0000085937 GCCTAGCTGTCATGGAAAGTT pLKO.1 1171 CDS 100% 5.625 3.938 N Hmbox1 n/a
6 TRCN0000301801 GCCTAGCTGTCATGGAAAGTT pLKO_005 1171 CDS 100% 5.625 3.938 N Hmbox1 n/a
7 TRCN0000085936 GAGTAGATTTACCTGGAGAAA pLKO.1 1145 CDS 100% 4.950 3.465 N Hmbox1 n/a
8 TRCN0000301802 GAGTAGATTTACCTGGAGAAA pLKO_005 1145 CDS 100% 4.950 3.465 N Hmbox1 n/a
9 TRCN0000085935 GCTGGAAACCATGTCTCACTA pLKO.1 365 CDS 100% 4.950 3.465 N Hmbox1 n/a
10 TRCN0000301803 GCTGGAAACCATGTCTCACTA pLKO_005 365 CDS 100% 4.950 3.465 N Hmbox1 n/a
11 TRCN0000085933 CCCAGAGTCATTAGGACTCTT pLKO.1 2591 3UTR 100% 0.495 0.347 N Hmbox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177338.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12575 pDONR223 100% 65.9% 65.8% None (many diffs) n/a
2 ccsbBroad304_12575 pLX_304 0% 65.9% 65.8% V5 (many diffs) n/a
3 TRCN0000472482 AATTTAAAATGATCCCAGGCATCA pLX_317 44.4% 65.9% 65.8% V5 (many diffs) n/a
Download CSV