Transcript: Mouse NM_177381.3

Mus musculus component of oligomeric golgi complex 3 (Cog3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cog3 (338337)
Length:
4222
CDS:
56..2542

Additional Resources:

NCBI RefSeq record:
NM_177381.3
NBCI Gene record:
Cog3 (338337)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065228 GCCAAGTTAGATGATTGTATA pLKO.1 734 CDS 100% 13.200 18.480 N COG3 n/a
2 TRCN0000175082 GCCAAGTTAGATGATTGTATA pLKO.1 734 CDS 100% 13.200 18.480 N Cog3 n/a
3 TRCN0000216960 CCTATGACTGTTCCACGATTT pLKO.1 2009 CDS 100% 10.800 15.120 N Cog3 n/a
4 TRCN0000248282 CCTATGACTGTTCCACGATTT pLKO_005 2009 CDS 100% 10.800 15.120 N Cog3 n/a
5 TRCN0000248285 TAATGAGTTGGAGACGATTAA pLKO_005 655 CDS 100% 13.200 10.560 N Cog3 n/a
6 TRCN0000248283 GTTGCTTGGTAGAGCATATTA pLKO_005 3707 3UTR 100% 15.000 10.500 N Cog3 n/a
7 TRCN0000248281 CCAAGATGAGCACCAACTTTA pLKO_005 1186 CDS 100% 13.200 9.240 N Cog3 n/a
8 TRCN0000175521 CCCTAAAGTCAGAACTCTAAT pLKO.1 967 CDS 100% 13.200 9.240 N Cog3 n/a
9 TRCN0000248284 GACAATGCCTTCACACTATTT pLKO_005 923 CDS 100% 13.200 9.240 N Cog3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177381.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12742 pDONR223 100% 48% 50.8% None (many diffs) n/a
2 ccsbBroad304_12742 pLX_304 0% 48% 50.8% V5 (many diffs) n/a
3 TRCN0000469829 GACATGATCCGTATTAACAAGGGA pLX_317 35.7% 48% 50.8% V5 (many diffs) n/a
Download CSV