Transcript: Human NM_177435.3

Homo sapiens peroxisome proliferator activated receptor delta (PPARD), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PPARD (5467)
Length:
2008
CDS:
310..1395

Additional Resources:

NCBI RefSeq record:
NM_177435.3
NBCI Gene record:
PPARD (5467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338385 ATCCACGACATCGAGACATTG pLKO_005 946 CDS 100% 10.800 15.120 N PPARD n/a
2 TRCN0000001664 CCGCAAACCCTTCAGTGATAT pLKO.1 1269 CDS 100% 13.200 9.240 N PPARD n/a
3 TRCN0000338383 CCGCAAACCCTTCAGTGATAT pLKO_005 1269 CDS 100% 13.200 9.240 N PPARD n/a
4 TRCN0000338384 TATTCATTGCGGCCATCATTC pLKO_005 1358 CDS 100% 10.800 7.560 N PPARD n/a
5 TRCN0000001662 CCTATTCATTGCGGCCATCAT pLKO.1 1356 CDS 100% 4.950 3.465 N PPARD n/a
6 TRCN0000010647 GTGTGGAAGCAGTTGGTGAAT pLKO.1 988 CDS 100% 4.950 2.970 N PPARD n/a
7 TRCN0000350974 GTGTGGAAGCAGTTGGTGAAT pLKO_005 988 CDS 100% 4.950 2.970 N PPARD n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1618 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1618 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1657 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1657 3UTR 100% 4.050 2.025 Y ORAI2 n/a
12 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1657 3UTR 100% 4.050 2.025 Y P3H4 n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1616 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1616 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1616 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06754 pDONR223 100% 99.9% 100% None 489C>T n/a
2 ccsbBroad304_06754 pLX_304 0% 99.9% 100% V5 489C>T n/a
3 TRCN0000470421 CTCTATGCCAAACTACCAATACAT pLX_317 35% 99.9% 100% V5 489C>T n/a
4 TRCN0000488494 TCCCTACTTCATCTTTCGAAAGCC pLX_317 20.4% 99.9% 100% V5 (not translated due to prior stop codon) 489C>T n/a
5 TRCN0000488417 ATGCTCAACAGCCAACGAACTGGC pLX_317 28.9% 99.8% 99.7% V5 489C>T;1083_1084insG n/a
Download CSV