Transcript: Human NM_177437.1

Homo sapiens taste 2 receptor member 60 (TAS2R60), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
TAS2R60 (338398)
Length:
957
CDS:
1..957

Additional Resources:

NCBI RefSeq record:
NM_177437.1
NBCI Gene record:
TAS2R60 (338398)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014139 GATAAGTTATTGGTTAGCCTA pLKO.1 166 CDS 100% 2.640 3.696 N TAS2R60 n/a
2 TRCN0000014138 CCATGCTCTTCATCTCATATT pLKO.1 758 CDS 100% 13.200 10.560 N TAS2R60 n/a
3 TRCN0000358212 CATGCTCTTCATCTCATATTT pLKO_005 759 CDS 100% 15.000 10.500 N TAS2R60 n/a
4 TRCN0000358211 TACGGAGCTACTGTGAGAAAT pLKO_005 554 CDS 100% 13.200 9.240 N TAS2R60 n/a
5 TRCN0000368555 TGTTGCCTTGTGATAAGTTAT pLKO_005 155 CDS 100% 13.200 9.240 N TAS2R60 n/a
6 TRCN0000358210 CCATCATCTTGGTTACCATTT pLKO_005 50 CDS 100% 10.800 7.560 N TAS2R60 n/a
7 TRCN0000014140 GCCATCATCTTGGTTACCATT pLKO.1 49 CDS 100% 4.950 3.465 N TAS2R60 n/a
8 TRCN0000014142 TCTCCTTACAACCTCAGGATT pLKO.1 681 CDS 100% 4.950 3.465 N TAS2R60 n/a
9 TRCN0000014141 CTGTGAGAAATTCTATCTCTT pLKO.1 564 CDS 100% 4.950 2.970 N TAS2R60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05438 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05438 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478889 CCAATGTACGGTTCGAATCTACCT pLX_317 44.3% 100% 100% V5 n/a
4 TRCN0000488112 TGTGACCAACCCGGTCATCACTCG pLX_317 27.5% 99.8% 100% V5 930T>C n/a
5 TRCN0000488194 AAGTGTTCCGTGAAACAATGACGA pLX_317 31.4% 99.8% 100% V5 (not translated due to prior stop codon) 930T>C n/a
6 ccsbBroadEn_15303 pDONR223 83% 99.3% 47.6% None (many diffs) n/a
7 ccsbBroad304_15303 pLX_304 0% 99.3% 47.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000476646 TAAGCATACTCGGTGAAAACATAG pLX_317 11.1% 99.3% 47.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV