Transcript: Mouse NM_178089.2

Mus musculus heterogeneous nuclear ribonucleoprotein U-like 1 (Hnrnpul1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpul1 (232989)
Length:
1233
CDS:
67..1089

Additional Resources:

NCBI RefSeq record:
NM_178089.2
NBCI Gene record:
Hnrnpul1 (232989)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123482 CGGACATTATGTCATGGACAA pLKO.1 354 CDS 100% 4.050 3.240 N Hnrnpul1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178089.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11594 pDONR223 100% 38% 38.7% None (many diffs) n/a
2 ccsbBroad304_11594 pLX_304 0% 38% 38.7% V5 (many diffs) n/a
3 TRCN0000471325 CGGTCTCGAGCTGCCTTCAGGCTC pLX_317 9.8% 38% 38.7% V5 (many diffs) n/a
4 ccsbBroadEn_07750 pDONR223 99.6% 35.6% 36.1% None (many diffs) n/a
5 ccsbBroad304_07750 pLX_304 0% 35.6% 36.1% V5 (many diffs) n/a
6 TRCN0000474866 CGACCAATATAGTCTTGACAGAGT pLX_317 17.8% 35.6% 36.1% V5 (many diffs) n/a
7 ccsbBroadEn_07749 pDONR223 100% 24.7% 25.5% None (many diffs) n/a
8 ccsbBroad304_07749 pLX_304 0% 24.7% 25.5% V5 (many diffs) n/a
9 TRCN0000480328 TTATTAAAAGCTTTGCAGTCAATT pLX_317 17.1% 24.7% 25.5% V5 (many diffs) n/a
Download CSV