Transcript: Human NM_178353.2

Homo sapiens late cornified envelope 1E (LCE1E), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
LCE1E (353135)
Length:
1200
CDS:
74..430

Additional Resources:

NCBI RefSeq record:
NM_178353.2
NBCI Gene record:
LCE1E (353135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429833 TAGCTGAGAGGTTCCAGCAAA pLKO_005 471 3UTR 100% 4.950 3.960 N LCE1E n/a
2 TRCN0000162959 GCTGCCTGAACTGAAGAAATA pLKO.1 655 3UTR 100% 13.200 9.240 N LCE1E n/a
3 TRCN0000422516 TAATGGCATTTAGAGACTTTC pLKO_005 556 3UTR 100% 10.800 7.560 N LCE1E n/a
4 TRCN0000166510 CCCACTCCTTCCACTAACAAT pLKO.1 1019 3UTR 100% 5.625 3.938 N LCE1E n/a
5 TRCN0000427812 AGCTCACGCTGCTGTATTCTG pLKO_005 633 3UTR 100% 4.950 3.465 N LCE1E n/a
6 TRCN0000162784 CCAAGGGACTGAAATAGCATT pLKO.1 873 3UTR 100% 4.950 3.465 N LCE1E n/a
7 TRCN0000160647 CTTTCAAATTCTGGTTCCTTT pLKO.1 907 3UTR 100% 4.950 3.465 N LCE1E n/a
8 TRCN0000161230 GCATTCACACACACATATGTA pLKO.1 1074 3UTR 100% 0.000 0.000 N LCE1E n/a
9 TRCN0000164006 CTGGTTCCTTTCACCTATGTA pLKO.1 917 3UTR 100% 5.625 3.375 N LCE1E n/a
10 TRCN0000166816 CTTGAAGTCTTGCCTGGAGAA pLKO.1 494 3UTR 100% 4.050 2.430 N LCE1E n/a
11 TRCN0000243982 CTAAGTGCCCTCCAGTCTCTT pLKO_005 177 CDS 100% 4.950 2.475 Y LCE1A n/a
12 TRCN0000162958 GACTTCCTCTTCCTTCTGATT pLKO.1 441 3UTR 100% 4.950 2.475 Y LCE1E n/a
13 TRCN0000262784 TAAGTGCCCTCCAGTCTCTTC pLKO_005 178 CDS 100% 4.050 2.025 Y LCE1D n/a
14 TRCN0000243981 AGTCTCTTCCTGCTGCAGTGT pLKO_005 190 CDS 100% 2.640 1.320 Y LCE1A n/a
15 TRCN0000262783 TCTCTTCCTGCTGCAGTGTCA pLKO_005 192 CDS 100% 2.640 1.320 Y LCE1D n/a
16 TRCN0000262785 CTCCCAAGTGCACTCCCAAGT pLKO_005 111 CDS 100% 1.350 0.675 Y LCE1D n/a
17 TRCN0000243068 TCCCAAGTGCACTCCCAAGTG pLKO_005 112 CDS 100% 1.350 0.675 Y LCE1F n/a
18 TRCN0000257212 CAGTGTCAGCTCCGGAGGCTG pLKO_005 205 CDS 100% 0.000 0.000 Y LCE1A n/a
19 TRCN0000257210 GGCTGCTGTGGCTCCAGCTCT pLKO_005 221 CDS 100% 0.000 0.000 Y LCE1A n/a
20 TRCN0000243065 GTCAGCTCCGGAGGCTGCTGT pLKO_005 209 CDS 100% 0.000 0.000 Y LCE1F n/a
21 TRCN0000262782 GTGTCAGCTCCGGAGGCTGCT pLKO_005 207 CDS 100% 0.000 0.000 Y LCE1D n/a
22 TRCN0000243066 TCCCAAGTGCCCTCCCAAGTG pLKO_005 124 CDS 100% 0.000 0.000 Y LCE1F n/a
23 TRCN0000243980 CCCAAGTGCCCTCCCAAGTGC pLKO_005 125 CDS 100% 0.000 0.000 Y LCE1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05520 pDONR223 100% 93.7% 93.2% None (many diffs) n/a
2 ccsbBroad304_05520 pLX_304 0% 93.7% 93.2% V5 (many diffs) n/a
3 TRCN0000473334 TCTCCACCCTGTCCCCAATCTTTT pLX_317 100% 93.7% 93.2% V5 (many diffs) n/a
4 ccsbBroadEn_15311 pDONR223 68% 68.3% 69.1% None (many diffs) n/a
5 ccsbBroad304_15311 pLX_304 0% 68.3% 69.1% V5 (many diffs) n/a
6 TRCN0000472237 AATCACACCAAATATCAACTATAT pLX_317 100% 34.4% 35.2% V5 (many diffs) n/a
Download CSV