Transcript: Human NM_181610.3

Homo sapiens keratin associated protein 19-4 (KRTAP19-4), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
KRTAP19-4 (337971)
Length:
342
CDS:
56..310

Additional Resources:

NCBI RefSeq record:
NM_181610.3
NBCI Gene record:
KRTAP19-4 (337971)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243213 CACGATATCAGAGGTCATAAG pLKO_005 262 CDS 100% 10.800 15.120 N KRTAP19-4 n/a
2 TRCN0000243212 CCTACCCTGAGGACACGATAT pLKO_005 249 CDS 100% 10.800 15.120 N KRTAP19-4 n/a
3 TRCN0000243214 GGTCATAAGAAGATCATTCAA pLKO_005 274 CDS 100% 5.625 7.875 N KRTAP19-4 n/a
4 TRCN0000243211 GATTCTCAATTCTACTGAAAT pLKO_005 228 CDS 100% 13.200 9.240 N KRTAP19-4 n/a
5 TRCN0000242583 CCATCATGCTATGGAGGATAT pLKO_005 206 CDS 100% 10.800 5.400 Y KRTAP19-5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16155 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16155 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475747 GGGGCGCCCCATCCTTCAAATCAG pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_09998 pDONR223 100% 99.6% 98.8% None 143A>G n/a
5 ccsbBroad304_09998 pLX_304 0% 99.6% 98.8% V5 143A>G n/a
6 TRCN0000475628 TCAATGGATGGTACCGACACTTTG pLX_317 100% 99.6% 98.8% V5 143A>G n/a
7 ccsbBroadEn_05433 pDONR223 100% 64.1% 57.4% None (many diffs) n/a
8 ccsbBroad304_05433 pLX_304 0% 64.1% 57.4% V5 (many diffs) n/a
9 TRCN0000466649 AACTCACAACGTTCTGCATCCTTT pLX_317 100% 64.1% 57.4% V5 (many diffs) n/a
10 ccsbBroadEn_05432 pDONR223 100% 58% 54.8% None (many diffs) n/a
11 ccsbBroad304_05432 pLX_304 0% 58% 54.8% V5 (many diffs) n/a
12 TRCN0000467303 CACTCGACAAAGCTGCATTGCTTT pLX_317 100% 58% 54.8% V5 (many diffs) n/a
Download CSV