Transcript: Human NM_182481.1

Homo sapiens BAGE family member 3 (BAGE3), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
BAGE3 (85318)
Length:
1891
CDS:
209..538

Additional Resources:

NCBI RefSeq record:
NM_182481.1
NBCI Gene record:
BAGE3 (85318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168837 CGCATGACATGCTGCATAATT pLKO.1 1321 3UTR 100% 15.000 7.500 Y BAGE3 n/a
2 TRCN0000371413 CTTCTGAAGTGAAGCATATTT pLKO_005 835 3UTR 100% 15.000 7.500 Y BAGE3 n/a
3 TRCN0000371417 TATAGCGGTTACTCCATTAAA pLKO_005 591 3UTR 100% 15.000 7.500 Y BAGE4 n/a
4 TRCN0000371414 ACTTTGGAGCCACTATCAAAT pLKO_005 344 CDS 100% 13.200 6.600 Y BAGE3 n/a
5 TRCN0000168224 CCTGAGGAACAGTTGGTTATA pLKO.1 1074 3UTR 100% 13.200 6.600 Y BAGE2 n/a
6 TRCN0000168341 GCATGGGTAAACCAGCTATTA pLKO.1 1415 3UTR 100% 13.200 6.600 Y BAGE2 n/a
7 TRCN0000371415 GATATAGCGGTTACTCCATTA pLKO_005 589 3UTR 100% 10.800 5.400 Y BAGE3 n/a
8 TRCN0000168060 CGGCTGGAAATGCAAATGAAT pLKO.1 759 3UTR 100% 5.625 2.813 Y BAGE3 n/a
9 TRCN0000168024 CGTGTGACAAAGGGTATCATA pLKO.1 698 3UTR 100% 5.625 2.813 Y BAGE2 n/a
10 TRCN0000167620 GAGGAACAGTTGGTTATAGAA pLKO.1 1077 3UTR 100% 5.625 2.813 Y BAGE5 n/a
11 TRCN0000168695 GCAAACAATCGGGAGAAGATA pLKO.1 656 3UTR 100% 5.625 2.813 Y BAGE4 n/a
12 TRCN0000172937 GCACTTTGGAGCCACTATCAA pLKO.1 342 CDS 100% 5.625 2.813 Y BAGE2 n/a
13 TRCN0000168196 CCTGAAAGATCGAAGGAAGAT pLKO.1 478 CDS 100% 4.950 2.475 Y BAGE2 n/a
14 TRCN0000167349 CTTTCAGGATTTCAGTCACAT pLKO.1 423 CDS 100% 4.950 2.475 Y BAGE2 n/a
15 TRCN0000168607 GATCGAAGGAAGATGCAAACT pLKO.1 485 CDS 100% 4.950 2.475 Y BAGE2 n/a
16 TRCN0000168340 GCAAGATGCTAGTGTGTGATA pLKO.1 677 3UTR 100% 4.950 2.475 Y BAGE4 n/a
17 TRCN0000168767 GCAGTTGTTAGAGGAACCTAA pLKO.1 944 3UTR 100% 4.950 2.475 Y BAGE4 n/a
18 TRCN0000168639 GTGTGTGATACGTGTGACAAA pLKO.1 688 3UTR 100% 4.950 2.475 Y BAGE5 n/a
19 TRCN0000166864 CAGATGTATCATTATCCTTGT pLKO.1 385 CDS 100% 4.050 2.025 Y BAGE3 n/a
20 TRCN0000167251 CAGATTTCTAATGAGGCTGAT pLKO.1 795 3UTR 100% 4.050 2.025 Y BAGE4 n/a
21 TRCN0000172796 GCTGGAAACATCATGCCAACA pLKO.1 1365 3UTR 100% 4.050 2.025 Y BAGE5 n/a
22 TRCN0000168727 GTTTCATACCAAGGAGGCAAA pLKO.1 1197 3UTR 100% 4.050 2.025 Y BAGE5 n/a
23 TRCN0000172899 GCTCCTGAAAGATCGAAGGAA pLKO.1 475 CDS 100% 3.000 1.500 Y BAGE2 n/a
24 TRCN0000173000 CCAGAACACATTGACCAAGCT pLKO.1 457 CDS 100% 2.640 1.320 Y BAGE2 n/a
25 TRCN0000168402 GAAAGATCGAAGGAAGATGCA pLKO.1 481 CDS 100% 2.640 1.320 Y BAGE3 n/a
26 TRCN0000167726 GAAATGCAAATGAATACCGAA pLKO.1 765 3UTR 100% 2.640 1.320 Y BAGE5 n/a
27 TRCN0000167436 GAACAGAAAGAAGATTCTGAA pLKO.1 1116 3UTR 100% 0.495 0.248 Y BAGE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09255 pDONR223 100% 99% 98.1% None 214C>G;309A>G;317A>G n/a
2 ccsbBroad304_09255 pLX_304 0% 99% 98.1% V5 214C>G;309A>G;317A>G n/a
3 TRCN0000468075 ATACTCGCAATGAAACTCCGACGA pLX_317 100% 99% 98.1% V5 214C>G;309A>G;317A>G n/a
4 ccsbBroadEn_00148 pDONR223 100% 36.3% 34.8% None (many diffs) n/a
5 ccsbBroad304_00148 pLX_304 0% 36.3% 34.8% V5 (many diffs) n/a
6 TRCN0000472238 AGTATTTGCGGTAGTCCAGACGAC pLX_317 100% 36.3% 34.8% V5 (many diffs) n/a
Download CSV