Transcript: Human NM_182918.4

Homo sapiens ETS transcription factor ERG (ERG), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-01
Taxon:
Homo sapiens (human)
Gene:
ERG (2078)
Length:
4904
CDS:
98..1537

Additional Resources:

NCBI RefSeq record:
NM_182918.4
NBCI Gene record:
ERG (2078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182918.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431367 CGTCCTCAGTTAGATCCTTAT pLKO_005 956 CDS 100% 10.800 15.120 N ERG n/a
2 TRCN0000432394 ATCTGGGCACTTACTACTAAA pLKO_005 1518 CDS 100% 13.200 10.560 N ERG n/a
3 TRCN0000412770 GAGACTCCTCTTCCACATTTG pLKO_005 686 CDS 100% 10.800 7.560 N ERG n/a
4 TRCN0000429354 GTGAGGACCAGTCGTTGTTTG pLKO_005 135 CDS 100% 10.800 7.560 N ERG n/a
5 TRCN0000420019 CCGTTACTACTATGACAAGAA pLKO_005 1204 CDS 100% 4.950 3.465 N ERG n/a
6 TRCN0000013917 GATGATGTTGATAAAGCCTTA pLKO.1 713 CDS 100% 4.050 2.835 N ERG n/a
7 TRCN0000013915 GCGGTGAAAGAATATGGCCTT pLKO.1 533 CDS 100% 2.160 1.512 N ERG n/a
8 TRCN0000013913 GCCCATCAACAGACGTTGATA pLKO.1 2029 3UTR 100% 0.563 0.394 N ERG n/a
9 TRCN0000013916 CCACCCACAGAAGATGAACTT pLKO.1 1366 CDS 100% 4.950 2.970 N ERG n/a
10 TRCN0000432206 AGCGCTACGCCTACAAGTTTG pLKO_005 1248 CDS 100% 10.800 15.120 N Erg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182918.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06179 pDONR223 100% 99.9% 100% None 552C>T n/a
2 TRCN0000465638 GCTAAATAAATTACTAAAGGACGC pLX_317 24.3% 99.9% 100% V5 552C>T n/a
3 ccsbBroad304_06179 pLX_304 26.4% 88.9% 73.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV