Transcript: Human NM_183004.5

Homo sapiens eukaryotic translation initiation factor 5 (EIF5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
EIF5 (1983)
Length:
5775
CDS:
507..1802

Additional Resources:

NCBI RefSeq record:
NM_183004.5
NBCI Gene record:
EIF5 (1983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183004.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313045 GACGTTGCAAAGGCGCTTAAT pLKO_005 627 CDS 100% 13.200 18.480 N Eif5 n/a
2 TRCN0000338532 GACGTTGCAAAGGCGCTTAAT pLKO_005 627 CDS 100% 13.200 18.480 N EIF5 n/a
3 TRCN0000106262 CCAGTTCTATCGCTACAAGAT pLKO.1 539 CDS 100% 4.950 6.930 N Eif5 n/a
4 TRCN0000146411 CCAGTTCTATCGCTACAAGAT pLKO.1 539 CDS 100% 4.950 6.930 N EIF5 n/a
5 TRCN0000313046 TGGATCTCATGAGGCGAATAA pLKO_005 737 CDS 100% 13.200 10.560 N Eif5 n/a
6 TRCN0000147335 GATGACGACATCGATATTGAT pLKO.1 1773 CDS 100% 5.625 4.500 N EIF5 n/a
7 TRCN0000149550 GCCAAAGAGATTCGTGTCAAA pLKO.1 1608 CDS 100% 4.950 3.960 N EIF5 n/a
8 TRCN0000338404 GCCAAAGAGATTCGTGTCAAA pLKO_005 1608 CDS 100% 4.950 3.960 N EIF5 n/a
9 TRCN0000106264 CCAACGTATCCCACCAAATAT pLKO.1 654 CDS 100% 15.000 10.500 N Eif5 n/a
10 TRCN0000146438 CCAACGTATCCCACCAAATAT pLKO.1 654 CDS 100% 15.000 10.500 N EIF5 n/a
11 TRCN0000338402 CCAACGTATCCCACCAAATAT pLKO_005 654 CDS 100% 15.000 10.500 N EIF5 n/a
12 TRCN0000148446 CCGTTGCTTTGGATTTGTGTT pLKO.1 4005 3UTR 100% 4.950 3.465 N EIF5 n/a
13 TRCN0000148235 GACTGTAAAGTCAGACAACAA pLKO.1 1751 CDS 100% 4.950 3.465 N EIF5 n/a
14 TRCN0000149636 GAGAACATTGAGGTGGTGTAT pLKO.1 1701 CDS 100% 4.950 3.465 N EIF5 n/a
15 TRCN0000147777 GCTTTAGATTTGGACACACAA pLKO.1 3076 3UTR 100% 4.950 3.465 N EIF5 n/a
16 TRCN0000147151 CACTCAGTGATGATTTGGAAA pLKO.1 1186 CDS 100% 4.950 2.970 N EIF5 n/a
17 TRCN0000338465 CACTCAGTGATGATTTGGAAA pLKO_005 1186 CDS 100% 4.950 2.970 N EIF5 n/a
18 TRCN0000106260 CCTCTAAGAAATATGTCTCAA pLKO.1 1579 CDS 100% 4.950 3.960 N Eif5 n/a
19 TRCN0000312109 CCTCTAAGAAATATGTCTCAA pLKO_005 1579 CDS 100% 4.950 3.960 N Eif5 n/a
20 TRCN0000106261 CCACCTGAGAATAGTGACATT pLKO.1 939 CDS 100% 4.950 3.465 N Eif5 n/a
21 TRCN0000312055 CCACCTGAGAATAGTGACATT pLKO_005 939 CDS 100% 4.950 3.465 N Eif5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183004.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06151 pDONR223 100% 99.9% 99.7% None 18C>G n/a
2 ccsbBroad304_06151 pLX_304 0% 99.9% 99.7% V5 18C>G n/a
3 TRCN0000471639 GACATCCACCACTGACTAGTGAGC pLX_317 40.2% 99.9% 99.7% V5 18C>G n/a
4 ccsbBroadEn_06152 pDONR223 100% 99.8% 99.5% None 16A>G;931C>A n/a
5 ccsbBroad304_06152 pLX_304 0% 99.8% 99.5% V5 16A>G;931C>A n/a
Download CSV