Transcript: Human NM_183393.3

Homo sapiens calcium dependent secretion activator (CADPS), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CADPS (8618)
Length:
5270
CDS:
388..4212

Additional Resources:

NCBI RefSeq record:
NM_183393.3
NBCI Gene record:
CADPS (8618)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159774 GCCCATGAGATGTTTATCAAT pLKO.1 4312 3UTR 100% 5.625 3.938 N CADPS n/a
2 TRCN0000159393 GCTTCATTCATGTACTATGTA pLKO.1 4515 3UTR 100% 5.625 3.938 N CADPS n/a
3 TRCN0000164609 CGGATGGACTTACAGCTTCAT pLKO.1 3976 CDS 100% 4.950 3.465 N CADPS n/a
4 TRCN0000159415 GCATGGATGAATTTATCTCTT pLKO.1 2378 CDS 100% 4.950 3.465 N CADPS n/a
5 TRCN0000119989 GCCAAGAGCATCAATACCATT pLKO.1 3620 CDS 100% 4.950 3.465 N Cadps n/a
6 TRCN0000163970 CGGTTAATCACTCCTGCCAAA pLKO.1 2929 CDS 100% 4.050 2.835 N CADPS n/a
7 TRCN0000161382 GCAGAGTTACTATGAGGTGTT pLKO.1 927 CDS 100% 4.050 2.835 N CADPS n/a
8 TRCN0000159633 GAAATGATAACACTCTTGGTT pLKO.1 3676 CDS 100% 3.000 2.100 N CADPS n/a
9 TRCN0000119990 CCTGTAACTTTGACCACGCTT pLKO.1 2405 CDS 100% 2.640 1.848 N Cadps n/a
10 TRCN0000164462 CTCTCACTCTTGGAAAGGGTT pLKO.1 2776 CDS 100% 2.640 1.848 N CADPS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11286 pDONR223 100% 58% 57.9% None (many diffs) n/a
2 ccsbBroad304_11286 pLX_304 0% 58% 57.9% V5 (many diffs) n/a
3 TRCN0000474770 CTTAATCAGTAGCTTACGTGGCTC pLX_317 10.7% 58% 57.9% V5 (many diffs) n/a
4 ccsbBroadEn_11285 pDONR223 100% 16.9% 16.9% None 1_3171del;3239_3240insGTTTGCTAAAATGTG n/a
5 ccsbBroad304_11285 pLX_304 0% 16.9% 16.9% V5 1_3171del;3239_3240insGTTTGCTAAAATGTG n/a
6 TRCN0000472605 AGTAATGACTTTTAGGTGGCCGAA pLX_317 76.9% 16.9% 16.9% V5 1_3171del;3239_3240insGTTTGCTAAAATGTG n/a
Download CSV