Transcript: Human NM_199054.2

Homo sapiens MAPK interacting serine/threonine kinase 2 (MKNK2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
MKNK2 (2872)
Length:
3805
CDS:
246..1643

Additional Resources:

NCBI RefSeq record:
NM_199054.2
NBCI Gene record:
MKNK2 (2872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006097 CGCCGTCAAGATCATTGAGAA pLKO.1 575 CDS 100% 4.950 6.930 N MKNK2 n/a
2 TRCN0000342285 CGCCGTCAAGATCATTGAGAA pLKO_005 575 CDS 100% 4.950 6.930 N MKNK2 n/a
3 TRCN0000006096 GCCATGTGTTAATGTTACGAT pLKO.1 3575 3UTR 100% 3.000 2.400 N MKNK2 n/a
4 TRCN0000006099 CCTGGGCGTCATCTTGTATAT pLKO.1 1085 CDS 100% 13.200 9.240 N MKNK2 n/a
5 TRCN0000006098 CCTAGAGCTGATTGAGTTCTT pLKO.1 671 CDS 100% 4.950 3.465 N MKNK2 n/a
6 TRCN0000342286 CCTAGAGCTGATTGAGTTCTT pLKO_005 671 CDS 100% 4.950 3.465 N MKNK2 n/a
7 TRCN0000006100 GCCTGCCAGAACATGCTGTTT pLKO.1 1182 CDS 100% 4.950 3.465 N MKNK2 n/a
8 TRCN0000194776 CATGTGTTAATGTTACGATGT pLKO.1 3577 3UTR 100% 4.050 2.835 N MKNK2 n/a
9 TRCN0000342226 CATGTGTTAATGTTACGATGT pLKO_005 3577 3UTR 100% 4.050 2.835 N MKNK2 n/a
10 TRCN0000199855 GAGGCTAGCATCTACGACAAG pLKO.1 1047 CDS 100% 4.050 2.835 N MKNK2 n/a
11 TRCN0000199237 CCTGCATCAACCTGATCACCA pLKO.1 544 CDS 100% 2.640 1.848 N MKNK2 n/a
12 TRCN0000199708 GCTGGCCTTCTCCCTAGACCA pLKO.1 314 CDS 100% 0.000 0.000 N MKNK2 n/a
13 TRCN0000199614 GCAGGTTTGAAGACGTCTACC pLKO.1 475 CDS 100% 4.050 2.430 N MKNK2 n/a
14 TRCN0000342284 GCAGGTTTGAAGACGTCTACC pLKO_005 475 CDS 100% 4.050 2.430 N MKNK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489397 ATTAACAAAAGCATAAAGCTATTC pLX_317 26.6% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000491691 CTCGCGTGTAATCTAAGGTGCTGG pLX_317 26.4% 99.9% 99.7% V5 1395_1396insG n/a
3 TRCN0000488777 TGAGCGTAAACATGGCAATGCACA pLX_317 22.9% 87.1% 81.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10857 pDONR223 100% 32.2% 27.5% None (many diffs) n/a
5 ccsbBroad304_10857 pLX_304 0% 32.2% 27.5% V5 (many diffs) n/a
6 TRCN0000472856 AGCCATGCCCCCAAACAGGTTCAT pLX_317 78.5% 32.2% 27.5% V5 (many diffs) n/a
7 ccsbBroadEn_14659 pDONR223 0% 32.2% 27.5% None (many diffs) n/a
8 ccsbBroad304_14659 pLX_304 0% 32.2% 27.5% V5 (many diffs) n/a
9 TRCN0000480148 CTGACCTTTGCCAAACTAGGCACA pLX_317 75.1% 32.2% 27.5% V5 (many diffs) n/a
Download CSV