Transcript: Human NM_206997.1

Homo sapiens G protein-coupled receptor 152 (GPR152), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
GPR152 (390212)
Length:
1429
CDS:
6..1418

Additional Resources:

NCBI RefSeq record:
NM_206997.1
NBCI Gene record:
GPR152 (390212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063564 CGACTACCTGATCCTACTCAA pLKO.1 845 CDS 100% 4.950 6.930 N GPR152 n/a
2 TRCN0000363296 TCCGACTACCTGATCCTACTC pLKO_005 843 CDS 100% 4.050 5.670 N GPR152 n/a
3 TRCN0000360163 ACCATTCTGTCAGCCTATGTG pLKO_005 726 CDS 100% 4.950 3.960 N GPR152 n/a
4 TRCN0000360165 CCGCTTCTACTACTTCCTATG pLKO_005 317 CDS 100% 6.000 4.200 N GPR152 n/a
5 TRCN0000063563 GCCGCTTCTACTACTTCCTAT pLKO.1 316 CDS 100% 4.950 3.465 N GPR152 n/a
6 TRCN0000063565 AGGACCATTCTGTCAGCCTAT pLKO.1 723 CDS 100% 4.050 2.835 N GPR152 n/a
7 TRCN0000363279 GCTAGATTCTGAGGGTCCAAC pLKO_005 1004 CDS 100% 4.050 2.835 N GPR152 n/a
8 TRCN0000063566 AGCTAGATTCTGAGGGTCCAA pLKO.1 1003 CDS 100% 2.640 1.848 N GPR152 n/a
9 TRCN0000063567 CAGATCCTAGAGATCCGGCAT pLKO.1 264 CDS 100% 2.160 1.512 N GPR152 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05612 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05612 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473330 CTCTATGTGATTTAAAAGACCTAA pLX_317 32.9% 100% 100% V5 n/a
4 TRCN0000487705 CTCTCCAGGTGTTGCTTATACACA pLX_317 20% 99.8% 99.7% V5 237G>A;1410_1411insG n/a
5 TRCN0000491263 TGATGCCCTCAATCCTATAAGTTT pLX_317 20.3% 99% 99.1% V5 (not translated due to prior stop codon) 1_12del;237G>A n/a
Download CSV