Transcript: Human NR_003148.3

Homo sapiens tropomyosin 3 pseudogene 9 (TPM3P9), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
TPM3P9 (147804)
Length:
2932
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003148.3
NBCI Gene record:
TPM3P9 (147804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161942 GAAATGCACCAAAGAGGAACA pLKO.1 792 3UTR 100% 4.050 2.430 N TPM3P9 n/a
2 TRCN0000274911 CTCGTAAGTTGGTGATCATTG pLKO_005 509 3UTR 100% 10.800 5.400 Y TPM3 n/a
3 TRCN0000274912 TCCAGGAAATCCAACTCAAAG pLKO_005 440 3UTR 100% 10.800 5.400 Y TPM3 n/a
4 TRCN0000159731 GATAAACTGAAATGCACCAAA pLKO.1 784 3UTR 100% 4.950 2.475 Y TPM3P9 n/a
5 TRCN0000161977 GCTTGACCTGAATGAGATGTA pLKO.1 846 3UTR 100% 4.950 2.475 Y TPM3P9 n/a
6 TRCN0000162786 CAGAACCTGAAGTGTCTGAGT pLKO.1 616 3UTR 100% 2.640 1.320 Y TPM3P9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15614 pDONR223 0% 23.8% None (many diffs) n/a
2 ccsbBroad304_15614 pLX_304 0% 23.8% V5 (many diffs) n/a
3 TRCN0000474312 TCGGGCATGCTATAACTGGACCTG pLX_317 60.2% 23.8% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_11198 pDONR223 100% 13.2% None (many diffs) n/a
5 ccsbBroad304_11198 pLX_304 0% 13.2% V5 (many diffs) n/a
6 TRCN0000473724 CAACCCTTACTTATGAATACCCCC pLX_317 86% 13.2% V5 (many diffs) n/a
7 ccsbBroadEn_13244 pDONR223 100% 9.3% None (many diffs) n/a
8 ccsbBroad304_13244 pLX_304 0% 9.3% V5 (many diffs) n/a
9 TRCN0000467014 TTGCCATGATGAACCCCCTTACCA pLX_317 100% 9.3% V5 (many diffs) n/a
Download CSV