Transcript: Human NR_004859.1

Homo sapiens SCAN domain containing 2 pseudogene (SCAND2P), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
SCAND2P (54581)
Length:
4509
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_004859.1
NBCI Gene record:
SCAND2P (54581)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_004859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021791 CTCCAAATAGTTAAACTGGAA pLKO.1 489 3UTR 100% 2.640 3.696 N SCAND2P n/a
2 TRCN0000021790 CTGGTGGAAGACTTGCAGAAA pLKO.1 795 3UTR 100% 4.950 3.465 N SCAND2P n/a
3 TRCN0000021789 GCTGCTTGTTATCCGGTCAAT pLKO.1 1286 3UTR 100% 4.950 3.465 N SCAND2P n/a
4 TRCN0000021792 AGCTCTGTTGTCAGTGGCTAA pLKO.1 643 3UTR 100% 4.050 2.430 N SCAND2P n/a
5 TRCN0000021793 CGTCATGTTGATAATCCAAAT pLKO.1 1322 3UTR 100% 10.800 5.400 Y SCAND2P n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3783 3UTR 100% 4.950 2.475 Y LOC387873 n/a
7 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 4001 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_004859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10239 pDONR223 100% 9.5% None (many diffs) n/a
2 ccsbBroad304_10239 pLX_304 0% 9.5% V5 (many diffs) n/a
3 TRCN0000465871 TTAGCTCTTCTGCGATGGGTGTTT pLX_317 58.8% 9.5% V5 (many diffs) n/a
4 ccsbBroadEn_15487 pDONR223 0% 3.5% None (many diffs) n/a
5 ccsbBroad304_15487 pLX_304 0% 3.5% V5 (many diffs) n/a
6 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 3.5% V5 (many diffs) n/a
Download CSV