Transcript: Human NR_026697.2

Homo sapiens reticulophagy regulator family member 3 (RETREG3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-17
Taxon:
Homo sapiens (human)
Gene:
RETREG3 (162427)
Length:
3778
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026697.2
NBCI Gene record:
RETREG3 (162427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266918 TCTGGGTTAGTGGGACCATTT pLKO_005 512 3UTR 100% 10.800 15.120 N Retreg3 n/a
2 TRCN0000142716 CAGCTGGACGATTCTACTGTT pLKO.1 880 3UTR 100% 4.950 6.930 N RETREG3 n/a
3 TRCN0000297886 CAGCTGGACGATTCTACTGTT pLKO_005 880 3UTR 100% 4.950 6.930 N RETREG3 n/a
4 TRCN0000143116 CAAGCAGAGAGAGAGACAATT pLKO.1 780 3UTR 100% 13.200 9.240 N RETREG3 n/a
5 TRCN0000145121 GCATTTGGCTTGATGATCATT pLKO.1 383 3UTR 100% 5.625 3.938 N RETREG3 n/a
6 TRCN0000280780 GCATTTGGCTTGATGATCATT pLKO_005 383 3UTR 100% 5.625 3.938 N RETREG3 n/a
7 TRCN0000141003 CCAAGCAGAGAGAGAGACAAT pLKO.1 779 3UTR 100% 4.950 3.465 N RETREG3 n/a
8 TRCN0000141498 CCTGACATCTCTTCGTCTTGT pLKO.1 352 3UTR 100% 4.950 3.465 N RETREG3 n/a
9 TRCN0000280781 CCTGACATCTCTTCGTCTTGT pLKO_005 352 3UTR 100% 4.950 3.465 N RETREG3 n/a
10 TRCN0000141450 CCTGTACAGACAATGGCACAT pLKO.1 950 3UTR 100% 4.050 2.835 N RETREG3 n/a
11 TRCN0000280782 CCTGTACAGACAATGGCACAT pLKO_005 950 3UTR 100% 4.050 2.835 N RETREG3 n/a
12 TRCN0000142506 GAATCCTTTGCCAGAGACCTT pLKO.1 1042 3UTR 100% 2.640 1.584 N RETREG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05117 pDONR223 100% 35.8% None 1_103del;447_448ins31;1471_3778del n/a
2 ccsbBroad304_05117 pLX_304 48% 35.8% V5 1_103del;447_448ins31;1471_3778del n/a
3 TRCN0000465478 GCCTGGGCGCCTGACCTGTTGATT pLX_317 23.2% 35.8% V5 1_103del;447_448ins31;1471_3778del n/a
4 ccsbBroadEn_12783 pDONR223 100% 4.9% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 4.9% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 4.9% V5 (many diffs) n/a
Download CSV