Transcript: Human NR_028293.2

Homo sapiens prostaglandin E receptor 3 (PTGER3), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PTGER3 (5733)
Length:
1987
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028293.2
NBCI Gene record:
PTGER3 (5733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357982 TGGTCTCCGCTCCTGATAATG pLKO_005 1122 3UTR 100% 13.200 18.480 N PTGER3 n/a
2 TRCN0000014157 CGGGACTAGCTCTTCGCATAA pLKO.1 890 3UTR 100% 10.800 7.560 N PTGER3 n/a
3 TRCN0000014155 CCTTGGGTTTACCTGCTGTTA pLKO.1 1266 3UTR 100% 4.950 3.465 N PTGER3 n/a
4 TRCN0000014156 GCTCCTGATAATGATGTTGAA pLKO.1 1130 3UTR 100% 4.950 3.465 N PTGER3 n/a
5 TRCN0000014153 CTTGAAGATAAATCTGCCTAA pLKO.1 1425 3UTR 100% 4.050 2.835 N PTGER3 n/a
6 TRCN0000014154 GCAGAAAGAATGCAACTTCTT pLKO.1 1202 3UTR 100% 0.495 0.347 N PTGER3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11069 pDONR223 100% 60% None (many diffs) n/a
2 ccsbBroad304_11069 pLX_304 0% 60% V5 (many diffs) n/a
3 TRCN0000471285 TCCTGTTCCCTAGCCTTGCCGCAA pLX_317 33.6% 60% V5 (many diffs) n/a
4 TRCN0000488834 GAAATTTGACATTTGATATATTTA pLX_317 32% 57.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489013 GTATTATTGAATAACAAGGGTCTC pLX_317 28.4% 56.6% V5 (many diffs) n/a
6 ccsbBroadEn_15551 pDONR223 0% 56.2% None (many diffs) n/a
7 ccsbBroad304_15551 pLX_304 0% 56.2% V5 (many diffs) n/a
8 TRCN0000470039 TCTTAGTTCCCACGTTCCCGAAGC pLX_317 34.5% 56.2% V5 (many diffs) n/a
9 TRCN0000489294 GACGCGATCCTTCCGCAAACTACC pLX_317 29% 56.2% V5 (many diffs) n/a
10 TRCN0000487757 CACGCCTCTGGACTTTCCCAGTCA pLX_317 21.6% 56.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV