Transcript: Human NR_028510.1

Homo sapiens TYRO3P protein tyrosine kinase pseudogene (TYRO3P), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
TYRO3P (7302)
Length:
864
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028510.1
NBCI Gene record:
TYRO3P (7302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023526 GCAGCTTGCATGAAGGAGTTT pLKO.1 150 3UTR 100% 4.950 2.475 Y Tyro3 n/a
2 TRCN0000023528 GCGAATGGAACTGGAGAACAT pLKO.1 840 3UTR 100% 4.950 2.475 Y Tyro3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487789 GGTACCGAAATCCGACTACACCGA pLX_317 21.1% 56.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15617 pDONR223 0% 27.6% None (many diffs) n/a
3 ccsbBroad304_15617 pLX_304 0% 27.6% V5 (many diffs) n/a
4 ccsbBroadEn_14871 pDONR223 0% 27.6% None (many diffs) n/a
5 ccsbBroad304_14871 pLX_304 0% 27.6% V5 (many diffs) n/a
6 TRCN0000479963 TCCTTCCTGGCGGTACGGTCCTAA pLX_317 13.4% 27.6% V5 (many diffs) n/a
7 TRCN0000488607 GTCTTAGTGAACTGCAAAAATAAT pLX_317 14.6% 27.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489876 GCATTCACCTTCAGGTGAGCCTTG pLX_317 15.5% 27.5% V5 (many diffs) n/a
9 ccsbBroadEn_13975 pDONR223 100% 27.5% None (many diffs) n/a
10 ccsbBroad304_13975 pLX_304 0% 27.5% V5 (not translated due to frame shift) (many diffs) n/a
11 TRCN0000474009 TGCGGAACTACTAATCCGCATTTC pLX_317 9.6% 27.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV