Construct: ORF TRCN0000487789
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021692.1_s317c1
- DNA Barcode:
- GGTACCGAAATCCGACTACACCGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- TYRO3 (7301)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000487789
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7302 | TYRO3P | TYRO3P protein tyrosine kin... | NR_028510.1 | 56.5% | (many diffs) | |
2 | human | 7301 | TYRO3 | TYRO3 protein tyrosine kinase | NM_001330264.1 | 49.9% | 49.7% | (many diffs) |
3 | human | 7301 | TYRO3 | TYRO3 protein tyrosine kinase | NM_006293.4 | 47.4% | 47.1% | (many diffs) |
4 | human | 7301 | TYRO3 | TYRO3 protein tyrosine kinase | XM_017022543.2 | 33.8% | 33.2% | (many diffs) |
5 | mouse | 22174 | Tyro3 | TYRO3 protein tyrosine kina... | XM_006499160.1 | 44.8% | 46.7% | (many diffs) |
6 | mouse | 22174 | Tyro3 | TYRO3 protein tyrosine kina... | NM_001290800.1 | 43.2% | 45% | (many diffs) |
7 | mouse | 22174 | Tyro3 | TYRO3 protein tyrosine kina... | NM_019392.2 | 43% | 44.8% | (many diffs) |
8 | mouse | 22174 | Tyro3 | TYRO3 protein tyrosine kina... | XM_017317147.1 | 42.3% | 44.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 90
- ORF end:
- 1359
- ORF length:
- 1269
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctttgg gcaagccttt gacagtgtca tggcccgggg agagccagcc gttcacttcc 121 gggcagcccg gtccttcaat cgagaaaggc ccgagcgcat cgaggccaca ttggacagct 181 tgggcatcag cgatgaacta aaggaaaaac tggaggatgt gctcatccca gagcagcagt 241 tcaccctggg ccggatgttg ggcaaaggag agtttggttc agtgcgggag gcccagctga 301 agcaagagga tagctccttt gtgaaagtgg ctgtgaagat gctgaaagct gacatcattg 361 cctcaagcga cattgaagag ttcctcaggg aagcagcttg catgaaggag tttgaccatc 421 cacacgtggc caaacttgtt ggggtaagcc tccggagcag ggctaaaggc cgtctcccca 481 tccccatggt catcttgccc ttcatgaagc atggggacct gcatgccttc ctgctcgcct 541 cccggattgg ggagaacccc tttaacctac ccctccagac cctgatccgg ttcatggtgg 601 acattgcctg cggcatggag tacctgagct ctcggaactt catccaccga gacctggctg 661 ctcggaattg catgctggca gaggacatga cagtgtgtgt ggctgacttc ggactctccc 721 ggaagatcta cagtggggac tactatcgtc aaggctgtgc ctccaaactg cctgtcaagt 781 ggctggccct ggagagcctg gccgacaacc tgtatactgt gcagagtgac gtgtgggcgt 841 tcggggtgac catgtgggag atcatgacac gtgggcagac gccatatgct ggcatcgaaa 901 acgctgagat ttacaactac ctcattggcg ggaaccgcct gaaacagcct ccggagtgta 961 tggaggacgt gtatgatctc atgtaccagt gctggagtgc tgaccccaag cagcgcccga 1021 gctttacttg tctgcgaatg gaactggaga acatcttggg ccagctgtct gtgctatctg 1081 ccagccagga ccccTTATAC ATCAACATCG AGAGAGCTGA GGAGCCCACT GCGGGAGGCA 1141 GCATGGAGCT ACCTGGCGGG GATCAGCCCT ACAGTGGGGC TGGGGATGGC AGTGGCATGG 1201 GGGCAGTGGG TGGCACTCCC AGTGACTGTC GGTACATACT CACCCCCGGA GGGCTGGCTG 1261 AGCAGCCAGG GCAGGCAGAG CACCAGCCAG AGAGTCCCCT CAATGAGACA CAGAGGCTTT 1321 TGCTGCTGCA GCAAGGGCTA CTGCCACACA GTAGCTGTTA GGACCCAGCT TTCTTGTACA 1381 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1441 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1501 AGGACGAGGT ACCGAAATCC GACTACACCG AACGCGTTAA GTCgacaatc aacctctgga 1561 ttacaaaatt tgtgaaagat t