Construct: ORF TRCN0000488607
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020367.1_s317c1
- DNA Barcode:
- GTCTTAGTGAACTGCAAAAATAAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- TYRO3 (7301)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488607
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7301 | TYRO3 | TYRO3 protein tyrosine kinase | NM_006293.4 | 99.8% | 99.5% | (many diffs) |
2 | human | 7301 | TYRO3 | TYRO3 protein tyrosine kinase | NM_001330264.1 | 94.7% | 94.6% | (many diffs) |
3 | human | 7301 | TYRO3 | TYRO3 protein tyrosine kinase | XM_017022543.2 | 86.1% | 85.6% | (many diffs) |
4 | human | 7302 | TYRO3P | TYRO3P protein tyrosine kin... | NR_028510.1 | 27.6% | (many diffs) | |
5 | mouse | 22174 | Tyro3 | TYRO3 protein tyrosine kina... | NM_019392.2 | 86.8% | 88.6% | (many diffs) |
6 | mouse | 22174 | Tyro3 | TYRO3 protein tyrosine kina... | XM_017317147.1 | 85.1% | 84.8% | (many diffs) |
7 | mouse | 22174 | Tyro3 | TYRO3 protein tyrosine kina... | NM_001290800.1 | 84.3% | 85.9% | (many diffs) |
8 | mouse | 22174 | Tyro3 | TYRO3 protein tyrosine kina... | XM_006499160.1 | 83.2% | 85.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2742
- ORF length:
- 2670
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcgctg aggcggagca tggggcggcc ggggctcccg ccgctgccgc 121 tgccgccgcc actgcggctc gggctgctgc tggcggctct ggcttctctg ctgctcccgg 181 agtccgccgc cgcaggtctg aagctcatgg gagccccggt gaagctgaca gtgtctcagg 241 ggcagccggt gaagctcaac tgcagtgtgg aggggatgga ggagcctgac atccagtggg 301 tgaaggatgg ggctgtggtc cagaacttgg accagttgta catcccagtc agcgagcagc 361 actggatcgg cttcctcagc ctgaagtcag tggagcgctc tgacgccggc cggtactggt 421 gccaggtgga ggatgggggt gaaaccgaga tctcccagcc agtgtggctc acggtagaag 481 gtgtgccatt tttcacagtg gagccaaaag atctggcagt gccacccaat gcccctttcc 541 aactgtcttg tgaggctgtg ggtccccctg aacctgttac cattgtctgg tggagaggaa 601 ctacgaagat cgggggaccc gctccctctc catctgtttt aaatgtaaca ggggtgaccc 661 agagcaccat gttttcctgt gaagctcaca acctaaaagg cctggcctct tctcgcacag 721 ccactgttca ccttcaagca ctgcctgcag cccccttcaa catcaccgtg acaaagcttt 781 ccagcagcaa cgctagtgtg gcctggatgc caggtgccga tggccgagct ctgctacagt 841 cctgtacagt tcaggtgaca caggccccag gaggctggga agtcctggct gttgtggtcc 901 ctgtgccccc ctttacctgc ctgctccggg acctggtgcc tgccaccaac tacagcctca 961 gggtgcgctg tgccaatgcc ttggggccct ctccctatgc tgactgggtg ccctttcaga 1021 ccaagggtct agccccagcc agcgctcccc aaaacctcca tgccatccgc acagattcag 1081 gcctcatctt ggagtgggaa gaagtgatcc ccgaggcccc tttggaaggc cccctgggac 1141 cctacaaact gtcctgggtt caagacaatg gaacccagga tgagctgaca gtggagggga 1201 ccagggccaa tttgacaggc tgggatcccc aaaaggacct gatcgtacgt gtgtgcgtct 1261 ccaatgcagt tggctgtgga ccctggagtc agccactggt ggtctcttct catgaccgtg 1321 caggccagca gggccctcct cacagccgca catcctgggt acctgtggtc cttggtgtgc 1381 taacggccct ggtgacggct gctgccctgg ccctcatcct gcttcgaaag agacggaaag 1441 agacgcggtt tgggcaagcc tttgacagtg tcatggcccg gggagagcca gccgttcact 1501 tccgggcagc ccggtccttc aatcgagaaa ggcccgagcg catcgaggcc acattggaca 1561 gcttgggcat cagcgatgaa ctaaaggaaa aactggagga tatgctcatc ccagagcagc 1621 agttcaccct gggccggatg ttgggcaaag gagagtttgg ttcagtgcgg gaggcccagc 1681 tgaagcaaga ggatggctcc tttgtgaaag tggctgtgaa gatgctgaaa gctgacatca 1741 ttgcctcaag cgacattgaa gagttcctca gggaagcagc ttgcatgaag gagtttgacc 1801 atccacacgt ggccaaactt gttggggtaa gcctccggag cagggctaaa ggccgtctcc 1861 ccatccccat ggtcatcttg cccttcatga agcatgggga cctgcatgcc ttcctgctcg 1921 cctcccggat tggggagaac ccctttaacc tacccctcca gaccctgatc cggttcatgg 1981 tggacattgc ctgcggcatg gagtacctga gctctcggaa cttcatccac cgagacctgg 2041 ctgctcggaa ttgcatgctg gcagaggaca tgacagtgtg tgtggctgac ttcggactct 2101 cccggaagat ctacagtggg gactactatc gtcaaggctg tgcctccaaa ctgcctgtca 2161 agtggctggc cctggagagc ctggccgaca acctgtatac tgtgcagagt gacgtgtggg 2221 cgttcggggt gaccatgtgg gagatcatga cacgtgggca gacgccatat gctggcatcg 2281 aaaacgctga gatttacaac tacctcattg gcgggaaccg cctgaaacag cctccggagt 2341 gtatggagga cgtgtatgaT CTCATGTACC AGTGCTGGAG TGCTGACCCC AAGCAGCGCC 2401 CGAGCTTTAC TTGTCTGCGA ATGGAACTGG AGAACATCTT GGGCCAGCTG TCTGTGCTAT 2461 CTGCCAGCCA GGACCCCTTA TACATCAACA TCGAGAGAGC TGAGGAGCCC ACTGCGGGAG 2521 GCAGCATGGA GCTACCTGGC GGGGATCAGC CCTACAGTGG GGCTGGGGAT GGCAGTGGCA 2581 TGGGGGCAGT GGGTGGCACT CCCAGTGACT GTCGGTACAT ACTCACCCCC GGAGGGCTGG 2641 CTGAGCAGCC AGGGCAGGCA GAGCACCAGC CAGAGAGTCC CCTCAATGAG ACACAGAGGC 2701 TTTTGCTGCT GCAGCAAGGG CTACTGCCAC ACAGTAGCTG TTAGGACCCA GCTTTCTTGT 2761 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 2821 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 2881 GAAAGGACGA GTCTTAGTGA ACTGCAAAAA TAATACGCGT TAAGTCgaca atcaacctct 2941 ggattacaaa atttgtgaaa gatt