Transcript: Mouse NR_037965.1

Mus musculus predicted gene 6644 (Gm6644), non-coding RNA.

Source:
NCBI, updated 2013-07-16
Taxon:
Mus musculus (mouse)
Gene:
Gm6644 (626009)
Length:
1369
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037965.1
NBCI Gene record:
Gm6644 (626009)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_037965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099130 GCAAACCAGATGGTGAGAGTT pLKO.1 1097 3UTR 100% 4.950 2.475 Y Gm12138 n/a
2 TRCN0000042185 GCTGAGAACTTGAAGGTCTTT pLKO.1 850 3UTR 100% 4.950 2.475 Y Akr1b3 n/a
3 TRCN0000325368 GCTGAGAACTTGAAGGTCTTT pLKO_005 850 3UTR 100% 4.950 2.475 Y Akr1b3 n/a
4 TRCN0000042187 GCTGTGCCAAACACAAGGATT pLKO.1 947 3UTR 100% 4.950 2.475 Y Akr1b3 n/a
5 TRCN0000325367 GCTGTGCCAAACACAAGGATT pLKO_005 947 3UTR 100% 4.950 2.475 Y Akr1b3 n/a
6 TRCN0000099131 CCCGTACCTAACTCAGGAGAA pLKO.1 603 3UTR 100% 4.050 2.025 Y Gm12138 n/a
7 TRCN0000099132 GCCTTGATGAGCTGTGCCAAA pLKO.1 937 3UTR 100% 4.050 2.025 Y Gm12138 n/a
8 TRCN0000099133 CCCGACTATTTCCCACTGGAT pLKO.1 397 3UTR 100% 2.640 1.320 Y Gm12138 n/a
9 TRCN0000042184 CGCCTTGATGAGCTGTGCCAA pLKO.1 936 3UTR 100% 0.880 0.440 Y Akr1b3 n/a
10 TRCN0000042186 CCATGACAAGAGCATGGTGAA pLKO.1 288 3UTR 100% 0.405 0.203 Y Akr1b3 n/a
11 TRCN0000042183 CCCTCTTCAGATTGAGAGGAT pLKO.1 528 3UTR 100% 0.264 0.132 Y Akr1b3 n/a
12 TRCN0000325297 CCCTCTTCAGATTGAGAGGAT pLKO_005 528 3UTR 100% 0.264 0.132 Y Akr1b3 n/a
13 TRCN0000305986 TACCAGTAGCCAAGGTGTTTC pLKO_005 1148 3UTR 100% 0.000 0.000 Y Akr1b3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00055 pDONR223 100% 59.6% None (many diffs) n/a
2 ccsbBroad304_00055 pLX_304 0% 59.6% V5 (many diffs) n/a
3 TRCN0000469510 GGTGGGCCTACCGTGCCCCGCTCA pLX_317 34.2% 59.6% V5 (many diffs) n/a
4 ccsbBroadEn_15354 pDONR223 0% 59.5% None (many diffs) n/a
5 ccsbBroad304_15354 pLX_304 0% 59.5% V5 (many diffs) n/a
6 TRCN0000480316 TGGCCCATCAAACGAGCCTTATTT pLX_317 48.3% 59.5% V5 (many diffs) n/a
Download CSV