Transcript: Human NR_040289.2

Homo sapiens aldo-keto reductase family 7 like (gene/pseudogene) (AKR7L), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-03-27
Taxon:
Homo sapiens (human)
Gene:
AKR7L (246181)
Length:
2183
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_040289.2
NBCI Gene record:
AKR7L (246181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_040289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430243 CAGTTTCTCAAAGGATTAAAC pLKO_005 1298 3UTR 100% 13.200 10.560 N AKR7L n/a
2 TRCN0000046413 GTGTACCAGCTTCTGGAAGGA pLKO.1 547 3UTR 100% 2.640 1.848 N AKR7L n/a
3 TRCN0000046414 CCACGAATGTCCCAACTACTT pLKO.1 820 3UTR 100% 4.950 2.970 N AKR7L n/a
4 TRCN0000413977 TTGCTACCAAGGCCAATCCAT pLKO_005 269 3UTR 100% 3.000 1.800 N AKR7L n/a
5 TRCN0000038985 CCTTTAATCAAGCCTGGCATT pLKO.1 792 3UTR 100% 4.050 2.025 Y AKR7A2 n/a
6 TRCN0000046415 GCCTTTAATCAAGCCTGGCAT pLKO.1 791 3UTR 100% 2.640 1.320 Y AKR7L n/a
7 TRCN0000046417 GAGGGCAAGTTCGTGGAGCTT pLKO.1 448 3UTR 100% 0.880 0.440 Y AKR7L n/a
8 TRCN0000038991 CACCGAGATAGACACGGCCTT pLKO.1 168 3UTR 100% 0.720 0.360 Y AKR7A3 n/a
9 TRCN0000046416 CGGTGGATGTACCACCACTCA pLKO.1 656 3UTR 100% 0.088 0.044 Y AKR7L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_040289.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07822 pDONR223 100% 32.1% None (many diffs) n/a
2 ccsbBroad304_07822 pLX_304 0% 32.1% V5 (many diffs) n/a
3 TRCN0000469339 ACCTGAGCTCTACTCTGGTAGCAA pLX_317 41.9% 32.1% V5 (many diffs) n/a
4 ccsbBroadEn_07823 pDONR223 100% 32% None (many diffs) n/a
5 ccsbBroad304_07823 pLX_304 0% 32% V5 (many diffs) n/a
6 TRCN0000465271 GACACAACAGCATGCGGAGCAAAC pLX_317 19.9% 32% V5 (many diffs) n/a
7 ccsbBroadEn_11281 pDONR223 100% 30.4% None (many diffs) n/a
8 ccsbBroad304_11281 pLX_304 0% 30.4% V5 (many diffs) n/a
9 TRCN0000468610 GGACTAGCCACGGGGCCGGGCTGA pLX_317 39% 30.4% V5 (many diffs) n/a
10 ccsbBroadEn_13444 pDONR223 100% 21% None 1_385del;845_2183del n/a
11 ccsbBroad304_13444 pLX_304 0% 21% V5 1_385del;845_2183del n/a
12 TRCN0000478142 GAGAGTCATAAAAGACCTGAGCGT pLX_317 70.7% 21% V5 1_385del;845_2183del n/a
Download CSV