Transcript: Human NR_045128.1

Homo sapiens taxilin gamma pseudogene, Y-linked (TXLNGY), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
TXLNGY (246126)
Length:
4648
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045128.1
NBCI Gene record:
TXLNGY (246126)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416856 GCCACAAGTAATAAACATTTA pLKO_005 240 3UTR 100% 13.200 10.560 N TXLNGY n/a
2 TRCN0000417411 AGAAACAAGCATGGCATATTT pLKO_005 2021 3UTR 100% 15.000 10.500 N TXLNGY n/a
3 TRCN0000420157 GAAAGTAGCAGATGTAGATTT pLKO_005 1409 3UTR 100% 13.200 9.240 N TXLNGY n/a
4 TRCN0000121982 GCTGTACAAGGCTCTTCAAAT pLKO.1 1334 3UTR 100% 13.200 9.240 N TXLNGY n/a
5 TRCN0000435831 TTGTGTGTTCATCACCTTAAA pLKO_005 1847 3UTR 100% 13.200 9.240 N TXLNGY n/a
6 TRCN0000421101 AGAAATGGTAATATGGTATAC pLKO_005 1208 3UTR 100% 10.800 7.560 N TXLNGY n/a
7 TRCN0000433287 CCGTCTGGTCAGCAAGCTTTA pLKO_005 372 3UTR 100% 10.800 7.560 N TXLNGY n/a
8 TRCN0000144736 GAATGAACTCAGTGAGAAACT pLKO.1 1361 3UTR 100% 4.950 3.465 N TXLNGY n/a
9 TRCN0000129995 GAGAGAAAGCAGATATGTTGT pLKO.1 169 3UTR 100% 4.950 3.465 N TXLNGY n/a
10 TRCN0000130770 GATGAAGAAGGCCGTGACTTT pLKO.1 267 3UTR 100% 4.950 3.465 N TXLNGY n/a
11 TRCN0000128432 GCCGTGACTTTATAACAAAGA pLKO.1 277 3UTR 100% 4.950 3.465 N TXLNGY n/a
12 TRCN0000140508 GCGGTTAGAGAAGCTGTACAA pLKO.1 1322 3UTR 100% 4.950 3.465 N TXLNGY n/a
13 TRCN0000140377 GAGAAGCTGTACAAGGCTCTT pLKO.1 1329 3UTR 100% 4.050 2.835 N TXLNGY n/a
14 TRCN0000122675 GCCTTCAAGCAGGAAACGGAA pLKO.1 1155 3UTR 100% 2.640 1.848 N TXLNGY n/a
15 TRCN0000130724 GACTCAAATTGCAGTGCCACA pLKO.1 225 3UTR 100% 2.160 1.512 N TXLNGY n/a
16 TRCN0000421178 TTATTGATGCAAGCCCTAAAC pLKO_005 438 3UTR 100% 10.800 6.480 N TXLNGY n/a
17 TRCN0000130784 GAGCTTCCTGAGCAAGAAGTA pLKO.1 345 3UTR 100% 4.950 2.970 N TXLNGY n/a
18 TRCN0000128404 GCAGCTCTCTGTAAGAAATAT pLKO.1 486 3UTR 100% 15.000 7.500 Y TXLNGY n/a
19 TRCN0000128355 GCAGATATGTTGTGTAACTCT pLKO.1 177 3UTR 100% 3.000 1.500 Y TXLNGY n/a
20 TRCN0000140138 GCACAATGGAAGAAGCTGGAA pLKO.1 136 3UTR 100% 2.640 1.320 Y TXLNG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13443 pDONR223 100% 7.2% None (many diffs) n/a
2 ccsbBroad304_13443 pLX_304 0% 7.2% V5 (many diffs) n/a
3 TRCN0000477707 TCCCCCGGGTTCTTTCCGTTATTG pLX_317 98.5% 7.2% V5 (many diffs) n/a
4 ccsbBroadEn_04409 pDONR223 96.1% 6.1% None (many diffs) n/a
5 ccsbBroad304_04409 pLX_304 0% 6.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV