Transcript: Mouse NR_073535.1

Mus musculus predicted pseudogene 10364 (Gm10364), non-coding RNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gm10364 (100151693)
Length:
1338
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073535.1
NBCI Gene record:
Gm10364 (100151693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_073535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041325 CTGGAGAAACCTGCCAAGTAT pLKO.1 868 3UTR 100% 5.625 2.813 Y LOC224923 n/a
2 TRCN0000041757 AGTGGAGATTGTTGCCATCAA pLKO.1 200 3UTR 100% 4.950 2.475 Y Gm5138 n/a
3 TRCN0000041232 CATGTTTGTGATGGGTGTGAA pLKO.1 512 3UTR 100% 4.950 2.475 Y LOC382043 n/a
4 TRCN0000036663 CCTCAACTACATGGTCTACAT pLKO.1 236 3UTR 100% 4.950 2.475 Y LOC392549 n/a
5 TRCN0000221345 GCTCATTTCCTGGTATGACAA pLKO.1 1040 3UTR 100% 4.950 2.475 Y GAPDH n/a
6 TRCN0000041756 GTCAAGCTCATTTCCTGGTAT pLKO.1 1035 3UTR 100% 4.950 2.475 Y Gm5138 n/a
7 TRCN0000041755 CATGGTCTACATGTTCCAGTA pLKO.1 245 3UTR 100% 4.050 2.025 Y Gm5138 n/a
8 TRCN0000041231 CCAAGTATGATGACATCAAGA pLKO.1 881 3UTR 100% 4.950 2.475 Y LOC382043 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00615 pDONR223 100% 61.9% None (many diffs) n/a
2 ccsbBroad304_00615 pLX_304 0% 61.9% V5 (many diffs) n/a
3 TRCN0000465685 TTTTCCTTCCTAATCTATAGCCTT pLX_317 31.2% 61.9% V5 (many diffs) n/a
4 ccsbBroadEn_06254 pDONR223 100% 61.8% None (many diffs) n/a
5 ccsbBroad304_06254 pLX_304 0% 61.8% V5 (many diffs) n/a
6 TRCN0000474158 ACCTGGGTGCATCCAGAAGGTTGA pLX_317 21.9% 61.8% V5 (many diffs) n/a
Download CSV