Transcript: Human NR_102390.1

Homo sapiens POTE ankyrin domain family member B2 (POTEB2), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-04-15
Taxon:
Homo sapiens (human)
Gene:
POTEB2 (100287399)
Length:
1478
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102390.1
NBCI Gene record:
POTEB2 (100287399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_102390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254473 AGATGAGATTCTGACTAATAA pLKO_005 1183 3UTR 100% 15.000 7.500 Y POTEC n/a
2 TRCN0000254475 CAATGGTGATGATGGATTAAT pLKO_005 1033 3UTR 100% 15.000 7.500 Y POTEC n/a
3 TRCN0000434864 GATGAGATTCTGACTAATAAA pLKO_005 1184 3UTR 100% 15.000 7.500 Y POTEB3 n/a
4 TRCN0000142532 GCCAAAGCACTGCTCTTATAT pLKO.1 685 3UTR 100% 15.000 7.500 Y POTEE n/a
5 TRCN0000145107 GCAATGGTGATGATGGATTAA pLKO.1 1032 3UTR 100% 13.200 6.600 Y POTEE n/a
6 TRCN0000148153 GCAATGGTGATGATGGATTAA pLKO.1 1032 3UTR 100% 13.200 6.600 Y POTED n/a
7 TRCN0000145382 GCTCTTATATGGTGCTGATAT pLKO.1 696 3UTR 100% 13.200 6.600 Y POTEE n/a
8 TRCN0000148072 GCTCTTATATGGTGCTGATAT pLKO.1 696 3UTR 100% 13.200 6.600 Y POTED n/a
9 TRCN0000265540 GGACAGACGATGTCAACTTAA pLKO_005 501 3UTR 100% 13.200 6.600 Y POTEC n/a
10 TRCN0000254474 TCTTATATGGTGCTGATATTG pLKO_005 698 3UTR 100% 13.200 6.600 Y POTEC n/a
11 TRCN0000265542 TGAGCTTTCTCTTAGTCATAA pLKO_005 1243 3UTR 100% 13.200 6.600 Y POTEC n/a
12 TRCN0000150907 GAAGAACAGAACACTGGAATA pLKO.1 1157 3UTR 100% 10.800 5.400 Y POTEG n/a
13 TRCN0000421750 GACAGACGATGTCAACTTAAC pLKO_005 502 3UTR 100% 10.800 5.400 Y POTEB3 n/a
14 TRCN0000418180 TCTGATAAAGGCCGTACAATG pLKO_005 549 3UTR 100% 10.800 5.400 Y POTEB3 n/a
15 TRCN0000179550 GCTGTGAAGAAGCCATTTGAT pLKO.1 70 3UTR 100% 5.625 2.813 Y POTEB3 n/a
16 TRCN0000146288 CAGGAAGATGAATGTGTGTTA pLKO.1 571 3UTR 100% 4.950 2.475 Y POTED n/a
17 TRCN0000156427 CCGCTCTACACTATGCTATCT pLKO.1 644 3UTR 100% 4.950 2.475 Y POTEH n/a
18 TRCN0000140774 GAAGACACTCAGGAGCAAGAT pLKO.1 195 3UTR 100% 4.950 2.475 Y POTEE n/a
19 TRCN0000157596 GAAGACACTCAGGAGCAAGAT pLKO.1 195 3UTR 100% 4.950 2.475 Y POTEH n/a
20 TRCN0000148154 GCCAATGGAAATTCAGAAGTA pLKO.1 466 3UTR 100% 4.950 2.475 Y POTED n/a
21 TRCN0000140286 GCTCTGATAAAGGCCGTACAA pLKO.1 547 3UTR 100% 4.950 2.475 Y POTEE n/a
22 TRCN0000154872 CAGAAAGGATCTCATCGTCAT pLKO.1 381 3UTR 100% 4.050 2.025 Y POTEH n/a
23 TRCN0000146454 CTGCTCTTATATGGTGCTGAT pLKO.1 694 3UTR 100% 4.050 2.025 Y POTED n/a
24 TRCN0000154544 GAGTATGGAAATACCGCTCTA pLKO.1 631 3UTR 100% 4.050 2.025 Y POTEH n/a
25 TRCN0000179963 CCTTTATGAAGACACTCAGGA pLKO.1 188 3UTR 100% 2.640 1.320 Y POTEB3 n/a
26 TRCN0000262860 GACAGACGATGTCAACTTAAT pLKO_005 502 3UTR 100% 13.200 6.600 Y POTEF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10007 pDONR223 100% 79% None (many diffs) n/a
2 ccsbBroad304_10007 pLX_304 0% 79% V5 (many diffs) n/a
3 TRCN0000470029 CGGTCGAATCTTAACATCGCAATG pLX_317 21.7% 79% V5 (many diffs) n/a
4 ccsbBroadEn_16159 pDONR223 0% 51.3% None (many diffs) n/a
5 ccsbBroad304_16159 pLX_304 0% 51.3% V5 (many diffs) n/a
6 TRCN0000481035 CTCACAAGTATCCACCTTTAGCGG pLX_317 40.3% 51.3% V5 (many diffs) n/a
7 ccsbBroadEn_13645 pDONR223 100% 50.4% None (many diffs) n/a
8 ccsbBroad304_13645 pLX_304 0% 50.4% V5 (many diffs) n/a
9 TRCN0000475599 CTACCGATTGCATGCTTACATGGA pLX_317 15.6% 50.4% V5 (many diffs) n/a
Download CSV