Transcript: Human NR_104475.1

Homo sapiens dual specificity phosphatase 22 (DUSP22), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
DUSP22 (56940)
Length:
3351
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104475.1
NBCI Gene record:
DUSP22 (56940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006929 GACACTGGTGATCGCATACAT pLKO.1 604 3UTR 100% 5.625 4.500 N DUSP22 n/a
2 TRCN0000342590 GACACTGGTGATCGCATACAT pLKO_005 604 3UTR 100% 5.625 4.500 N DUSP22 n/a
3 TRCN0000342638 ATGTTGAGAACTAAGGATATT pLKO_005 2997 3UTR 100% 13.200 9.240 N DUSP22 n/a
4 TRCN0000381997 AGCATGAGGTCCATCAGTATC pLKO_005 735 3UTR 100% 10.800 7.560 N DUSP22 n/a
5 TRCN0000006925 CCAGTAGTGATTTGTAAACTT pLKO.1 2937 3UTR 100% 5.625 3.938 N DUSP22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104475.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03758 pDONR223 100% 13.6% None (many diffs) n/a
2 ccsbBroad304_03758 pLX_304 0% 13.6% V5 (many diffs) n/a
3 TRCN0000471126 AGGGGACACCACATGGATCACCAT pLX_317 75% 13.6% V5 (many diffs) n/a
4 TRCN0000491693 CTTAATGCTCTTTTTAATCCTTGT pLX_317 56.9% 13.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_08670 pDONR223 100% 6.7% None (many diffs) n/a
6 ccsbBroad304_08670 pLX_304 0% 6.7% V5 (many diffs) n/a
7 TRCN0000472924 CCTTTTCGAACATGATCGATGCCA pLX_317 100% 6.7% V5 (many diffs) n/a
Download CSV