Transcript: Human NR_111962.1

Homo sapiens golgin A6 family like 17, pseudogene (GOLGA6L17P), non-coding RNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Homo sapiens (human)
Gene:
GOLGA6L17P (642402)
Length:
1865
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111962.1
NBCI Gene record:
GOLGA6L17P (642402)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_111962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269219 GGATTCAAGCTCCGCAATAAT pLKO_005 358 3UTR 100% 15.000 7.500 Y GOLGA6L9 n/a
2 TRCN0000162932 GCAGTTGGAGCAGCAAGTAAA pLKO.1 1537 3UTR 100% 13.200 6.600 Y GOLGA8B n/a
3 TRCN0000269218 CAGTTGGAGCAGCAAGTAAAG pLKO_005 1538 3UTR 100% 10.800 5.400 Y GOLGA6L9 n/a
4 TRCN0000283941 TGCCGAGAACAGGGAGCTAAA pLKO_005 1774 3UTR 100% 10.800 5.400 Y GOLGA6L9 n/a
5 TRCN0000150250 GAGAAGAAGCATGAGATACAT pLKO.1 428 3UTR 100% 5.625 2.813 Y GOLGA6L5P n/a
6 TRCN0000180631 GAGGTGGAGAAGCTGTTAGAA pLKO.1 1067 3UTR 100% 5.625 2.813 Y GOLGA6L9 n/a
7 TRCN0000180938 GAAGAGGTGGAGAAGCTGTTA pLKO.1 1064 3UTR 100% 4.950 2.475 Y GOLGA6L5P n/a
8 TRCN0000179455 GAGGAGAAGAAGCATGAGATA pLKO.1 425 3UTR 100% 4.950 2.475 Y GOLGA6L5P n/a
9 TRCN0000149653 GAGGAGCTTGTTCAAACTCAA pLKO.1 466 3UTR 100% 4.950 2.475 Y GOLGA6L5P n/a
10 TRCN0000180460 GCAAGTAAAGGAGCTGGAGAA pLKO.1 1549 3UTR 100% 4.050 2.025 Y GOLGA6L9 n/a
11 TRCN0000149152 GCATGAGATACATCTGGTACA pLKO.1 436 3UTR 100% 4.050 2.025 Y GOLGA6L5P n/a
12 TRCN0000269223 AGAGGTGGAGAAGCTGTTAAA pLKO_005 1066 3UTR 100% 13.200 6.600 Y GOLGA6L9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15313 pDONR223 80.2% 64.5% None (many diffs) n/a
2 ccsbBroad304_15313 pLX_304 0% 64.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13690 pDONR223 100% 43.8% None (many diffs) n/a
4 ccsbBroad304_13690 pLX_304 0% 43.8% V5 (many diffs) n/a
5 ccsbBroadEn_15348 pDONR223 64.5% 29.7% None (many diffs) n/a
6 ccsbBroad304_15348 pLX_304 0% 29.7% V5 (many diffs) n/a
7 TRCN0000473379 GCTTCCGCCGAACCGATGGAGCTC pLX_317 100% 17.6% V5 (many diffs) n/a
Download CSV