Transcript: Mouse NR_125833.1

Mus musculus CLK4-associating serine/arginine rich protein (Clasrp), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2016-09-16
Taxon:
Mus musculus (mouse)
Gene:
Clasrp (53609)
Length:
2468
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_125833.1
NBCI Gene record:
Clasrp (53609)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_125833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307395 AGAATGGGAACGCCAATATAG pLKO_005 2240 3UTR 100% 13.200 18.480 N Clasrp n/a
2 TRCN0000294731 CCGTTCAGGTGACCGCTATAA pLKO_005 1477 3UTR 100% 13.200 18.480 N Clasrp n/a
3 TRCN0000123556 GCTACACCTATGAAGATAGTA pLKO.1 583 3UTR 100% 5.625 4.500 N Clasrp n/a
4 TRCN0000294730 AGCAGGTGGCTGATCTCAATA pLKO_005 723 3UTR 100% 13.200 9.240 N Clasrp n/a
5 TRCN0000307393 AGGAGTCAGACGAGCGGAAAT pLKO_005 403 3UTR 100% 10.800 7.560 N Clasrp n/a
6 TRCN0000123555 CGGGAGTACTATGAGAAGATT pLKO.1 171 3UTR 100% 5.625 3.938 N Clasrp n/a
7 TRCN0000123554 GCTACAGTCGAGAGTACAGTT pLKO.1 2287 3UTR 100% 4.950 3.465 N Clasrp n/a
8 TRCN0000123558 CGCTTTGATGTTCGTGCACAT pLKO.1 327 3UTR 100% 4.050 2.835 N Clasrp n/a
9 TRCN0000287219 CGCTTTGATGTTCGTGCACAT pLKO_005 327 3UTR 100% 4.050 2.835 N Clasrp n/a
10 TRCN0000123557 GAGGCCATCAAACATGCCAAA pLKO.1 815 3UTR 100% 4.050 2.835 N Clasrp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_125833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11599 pDONR223 100% 21.8% None (many diffs) n/a
2 ccsbBroad304_11599 pLX_304 0% 21.8% V5 (many diffs) n/a
3 TRCN0000473824 GGGCTTCATTACTAATACTCACGT pLX_317 73% 21.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV