Transcript: Human NR_130755.2

Homo sapiens FGFR1OP N-terminal like (FOPNL), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FOPNL (123811)
Length:
2179
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130755.2
NBCI Gene record:
FOPNL (123811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135698 CAATGGATGACCACCTAAGAA pLKO.1 376 3UTR 100% 5.625 4.500 N FOPNL n/a
2 TRCN0000134547 GCACCACTAATGTTTGTAGAA pLKO.1 539 3UTR 100% 4.950 3.960 N FOPNL n/a
3 TRCN0000136385 CCTAAGAAAGGAGGAACAGAA pLKO.1 389 3UTR 100% 4.950 3.465 N FOPNL n/a
4 TRCN0000134590 GCCCTTAAAGTTTGTAAGGAA pLKO.1 993 3UTR 100% 0.300 0.210 N FOPNL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04776 pDONR223 100% 19.3% None 1_18del;244_245ins85;456_2179del n/a
2 ccsbBroad304_04776 pLX_304 0% 19.3% V5 1_18del;244_245ins85;456_2179del n/a
3 TRCN0000475080 AAAAACCCATATGCCCGTAGCTCC pLX_317 70.4% 19.3% V5 1_18del;244_245ins85;456_2179del n/a
4 ccsbBroadEn_12783 pDONR223 100% 8.6% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 8.6% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 8.6% V5 (many diffs) n/a
7 ccsbBroadEn_11616 pDONR223 100% 7.8% None (many diffs) n/a
8 ccsbBroad304_11616 pLX_304 0% 7.8% V5 (many diffs) n/a
9 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 7.8% V5 (many diffs) n/a
10 ccsbBroadEn_10261 pDONR223 100% 2.8% None (many diffs) n/a
11 ccsbBroad304_10261 pLX_304 0% 2.8% V5 (many diffs) n/a
12 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2.8% V5 (many diffs) n/a
Download CSV