Transcript: Human NR_130947.1

Homo sapiens WD repeat domain 73 (WDR73), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
WDR73 (84942)
Length:
3106
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130947.1
NBCI Gene record:
WDR73 (84942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135695 CGTAGTGATATTGCGAAGGTT pLKO.1 1300 3UTR 100% 3.000 4.200 N WDR73 n/a
2 TRCN0000135232 CGAAGGTTAGAAGAAACGCAT pLKO.1 1313 3UTR 100% 2.640 3.696 N WDR73 n/a
3 TRCN0000330900 CGAAGGTTAGAAGAAACGCAT pLKO_005 1313 3UTR 100% 2.640 3.696 N WDR73 n/a
4 TRCN0000330839 AGTGGCCTTCCAGGTTGTTAT pLKO_005 281 3UTR 100% 13.200 9.240 N WDR73 n/a
5 TRCN0000330838 ATGGTACAGTCCAGGTCTATG pLKO_005 870 3UTR 100% 10.800 7.560 N WDR73 n/a
6 TRCN0000137656 CCTGAAGAATTGCTTGGCCAT pLKO.1 838 3UTR 100% 2.160 1.512 N WDR73 n/a
7 TRCN0000330836 GAGGACAGTGATGTCATTAAA pLKO_005 323 3UTR 100% 15.000 9.000 N WDR73 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2788 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2829 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2829 3UTR 100% 4.050 2.025 Y ORAI2 n/a
11 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2829 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1707 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2959 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130947.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11616 pDONR223 100% 5.5% None (many diffs) n/a
2 ccsbBroad304_11616 pLX_304 0% 5.5% V5 (many diffs) n/a
3 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 5.5% V5 (many diffs) n/a
Download CSV