Transcript: Human NR_135688.2

Homo sapiens dual specificity phosphatase 19 (DUSP19), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DUSP19 (142679)
Length:
5144
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135688.2
NBCI Gene record:
DUSP19 (142679)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002687 CGGAATAATCTCAGGAAGCAA pLKO.1 224 3UTR 100% 3.000 4.200 N DUSP19 n/a
2 TRCN0000002689 TCGTACATATCAAGAGGGCAA pLKO.1 731 3UTR 100% 2.160 3.024 N DUSP19 n/a
3 TRCN0000356163 ACCTGCAAGTTGGCGTTATTA pLKO_005 375 3UTR 100% 15.000 12.000 N DUSP19 n/a
4 TRCN0000356220 AGCATGGAGAGAATCATTTAA pLKO_005 1100 3UTR 100% 15.000 10.500 N DUSP19 n/a
5 TRCN0000002688 GCCTGGATTGTGTATTATTTA pLKO.1 3327 3UTR 100% 15.000 10.500 N DUSP19 n/a
6 TRCN0000356162 ATGGAGCAGCTTCGTACATAT pLKO_005 720 3UTR 100% 13.200 9.240 N DUSP19 n/a
7 TRCN0000356221 TGCATAAATGGAGGTCAATTT pLKO_005 911 3UTR 100% 13.200 9.240 N DUSP19 n/a
8 TRCN0000002690 GACAACGCTAACTGGAAAGAA pLKO.1 256 3UTR 100% 5.625 3.938 N DUSP19 n/a
9 TRCN0000002691 CTATATTGGATCTGCCTGAAA pLKO.1 487 3UTR 100% 4.950 3.465 N DUSP19 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3288 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3288 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488400 AAGTGTCATGGATGGAGCAAACGT pLX_317 50.8% 11.7% V5 (not translated due to prior stop codon) 1_182del;411_412ins47;792_5144del n/a
2 ccsbBroadEn_04960 pDONR223 100% 11.6% None 1_187del;411_412ins47;792_5144del n/a
3 ccsbBroad304_04960 pLX_304 0% 11.6% V5 1_187del;411_412ins47;792_5144del n/a
4 TRCN0000469812 CGGAGCATGTTTCTCCCACCTGAT pLX_317 69.1% 11.6% V5 1_187del;411_412ins47;792_5144del n/a
5 ccsbBroadEn_10792 pDONR223 100% 4.1% None (many diffs) n/a
6 ccsbBroad304_10792 pLX_304 0% 4.1% V5 (many diffs) n/a
7 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 4.1% V5 (many diffs) n/a
Download CSV