Transcript: Human NR_138092.2

Homo sapiens HEAT repeat containing 3 (HEATR3), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
HEATR3 (55027)
Length:
4696
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138092.2
NBCI Gene record:
HEATR3 (55027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153313 GCATTGAACATGCTGGAATCA pLKO.1 847 3UTR 100% 4.950 6.930 N HEATR3 n/a
2 TRCN0000156533 GCAGTGATGAAAGTGACGCAT pLKO.1 1608 3UTR 100% 2.640 3.696 N HEATR3 n/a
3 TRCN0000153498 CCAAAGCATTGCTTGGATGTT pLKO.1 3499 3UTR 100% 4.950 3.465 N HEATR3 n/a
4 TRCN0000152450 CCAGCAGTGAAGAAACTTCAA pLKO.1 3439 3UTR 100% 4.950 3.465 N HEATR3 n/a
5 TRCN0000152833 GAACCCTACTTGGAAACCTTT pLKO.1 1786 3UTR 100% 4.950 3.465 N HEATR3 n/a
6 TRCN0000153570 GCCAAAGAAGATGGTACACTT pLKO.1 2153 3UTR 100% 4.950 3.465 N HEATR3 n/a
7 TRCN0000152801 GCTTGAAGTTACCACCAAAGA pLKO.1 2203 3UTR 100% 4.950 3.465 N HEATR3 n/a
8 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 1085 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
9 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2684 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2684 3UTR 100% 4.050 2.025 Y ORAI2 n/a
11 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2684 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1155 3UTR 100% 1.080 0.540 Y GPR83 n/a
13 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1155 3UTR 100% 1.080 0.540 Y MYORG n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3252 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3252 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08456 pDONR223 100% 43.3% None (many diffs) n/a
2 ccsbBroad304_08456 pLX_304 0% 43.3% V5 (many diffs) n/a
3 ccsbBroadEn_12783 pDONR223 100% 4% None (many diffs) n/a
4 ccsbBroad304_12783 pLX_304 0% 4% V5 (many diffs) n/a
5 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 4% V5 (many diffs) n/a
Download CSV