Transcript: Human NR_146231.1

Homo sapiens PKD1P3-NPIPA1 readthrough (PKD1P3-NPIPA1), non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
PKD1P3-NPIPA1 (109951030)
Length:
7365
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146231.1
NBCI Gene record:
PKD1P3-NPIPA1 (109951030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264027 CGTAGACAGGAAGGAATTAAA pLKO_005 6487 3UTR 100% 15.000 7.500 Y PKD1P1 n/a
2 TRCN0000264029 CCACCCTCAGCGGATGATAAT pLKO_005 7169 3UTR 100% 13.200 6.600 Y PKD1P1 n/a
3 TRCN0000139541 CCACCCTCAGTGGATGATAAT pLKO.1 7238 3UTR 100% 13.200 6.600 Y NPIPB15 n/a
4 TRCN0000140226 GCCGTAGACAGGAAGGAATTA pLKO.1 6485 3UTR 100% 13.200 6.600 Y NPIPA1 n/a
5 TRCN0000256807 TCCACCCTCAGCGGATGATAA pLKO_005 7168 3UTR 100% 13.200 6.600 Y NPIPB3 n/a
6 TRCN0000264028 TCTACCCTCAGCGGATGATAA pLKO_005 7111 3UTR 100% 13.200 6.600 Y PKD1P1 n/a
7 TRCN0000264025 TGGAAGTCCTTGGTTACTTAT pLKO_005 6318 3UTR 100% 13.200 6.600 Y PKD1P1 n/a
8 TRCN0000145199 GAAACCAAAGTTCGAGCTAAA pLKO.1 6547 3UTR 100% 10.800 5.400 Y NPIPA1 n/a
9 TRCN0000145534 CTGAGGAAACTAAGCATGAAA pLKO.1 6646 3UTR 100% 5.625 2.813 Y NPIPA1 n/a
10 TRCN0000141615 CCTCCAACTCAACAACATTCT pLKO.1 7022 3UTR 100% 4.950 2.475 Y NPIPA1 n/a
11 TRCN0000062320 CGAGGAGTTCTGTGTCTACAA pLKO.1 3727 3UTR 100% 4.950 2.475 Y PKD1 n/a
12 TRCN0000141507 CTTCTGCAAGAAAGCCTCTTT pLKO.1 6821 3UTR 100% 4.950 2.475 Y NPIPB15 n/a
13 TRCN0000142420 GAGGACTACTACAGATGCAAA pLKO.1 6793 3UTR 100% 4.950 2.475 Y NPIPA1 n/a
14 TRCN0000144792 GTAAGATGAAGGTGACAACAA pLKO.1 6572 3UTR 100% 4.950 2.475 Y NPIPA1 n/a
15 TRCN0000062321 GCTATGGAGAGAGTTCCTCTT pLKO.1 1974 3UTR 100% 4.050 2.025 Y PKD1 n/a
16 TRCN0000141673 CCTCAGTGGATGATAATCTCA pLKO.1 7242 3UTR 100% 3.000 1.500 Y NPIPB15 n/a
17 TRCN0000145269 GTCTTTCCTGAAGACTATCTT pLKO.1 6402 3UTR 100% 0.563 0.281 Y NPIPB15 n/a
18 TRCN0000264026 TACCTCACAGCTGAAACTTTA pLKO_005 6974 3UTR 100% 0.000 0.000 Y PKD1P1 n/a
19 TRCN0000141237 CCTCAGTGGATGATAATCTGA pLKO.1 7242 3UTR 100% 3.000 1.500 Y NPIPB15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16160 pDONR223 0% 9.1% None (many diffs) n/a
2 ccsbBroad304_16160 pLX_304 0% 9.1% V5 (many diffs) n/a
3 TRCN0000473627 ATCAATCAGAAAGTCAGCTAAGTC pLX_317 59.4% 9.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15304 pDONR223 57.8% 5.3% None (many diffs) n/a
5 ccsbBroad304_15304 pLX_304 0% 5.3% V5 (many diffs) n/a
6 TRCN0000465408 CACCCATAGAAGAATTACCGCCGA pLX_317 100% 2.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV