Transcript: Human NR_146295.2

Homo sapiens RAB36, member RAS oncogene family (RAB36), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RAB36 (9609)
Length:
4892
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146295.2
NBCI Gene record:
RAB36 (9609)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146295.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047788 CGCTTTGAGATTGCTGGGATT pLKO.1 298 3UTR 100% 4.050 5.670 N RAB36 n/a
2 TRCN0000047790 GCCGCATGTGAGCAGGCCGAA pLKO.1 537 3UTR 100% 0.000 0.000 N RAB36 n/a
3 TRCN0000381825 CACACACACGGACAGGAATTT pLKO_005 839 3UTR 100% 13.200 9.240 N RAB36 n/a
4 TRCN0000381996 GCACTGTGGTGATCCCATAAA pLKO_005 1053 3UTR 100% 13.200 9.240 N RAB36 n/a
5 TRCN0000381964 ACTTTGAAATTGAGCGCTTTG pLKO_005 284 3UTR 100% 6.000 4.200 N RAB36 n/a
6 TRCN0000382336 TGCATCGCATCTGCCTACTAC pLKO_005 367 3UTR 100% 4.950 3.465 N RAB36 n/a
7 TRCN0000382321 TTCCTCGTGGGAACCAAGAAG pLKO_005 505 3UTR 100% 4.950 3.465 N RAB36 n/a
8 TRCN0000047792 CCAGGTGATCATCACGGCCTT pLKO.1 396 3UTR 100% 0.720 0.504 N RAB36 n/a
9 TRCN0000047791 AGGTCGGCAATGGAGACCTAA pLKO.1 718 3UTR 100% 0.495 0.347 N RAB36 n/a
10 TRCN0000379781 ATTGCTGGGATTCCCTATAGC pLKO_005 307 3UTR 100% 4.950 2.970 N RAB36 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2727 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2727 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146295.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 4.4% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 4.4% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 4.4% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 3.8% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 3.8% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 3.8% V5 (many diffs) n/a
7 ccsbBroadEn_10261 pDONR223 100% 1.3% None (many diffs) n/a
8 ccsbBroad304_10261 pLX_304 0% 1.3% V5 (many diffs) n/a
9 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.3% V5 (many diffs) n/a
Download CSV